ACD HybEZ II Hybridization System 220v

ACD HybEZ II Hybridization System 220v 

To Order Contact us:

Hybridization Solution

K2191050-2 5 ml
EUR 157
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Human Cytokine Primer Library II

HCA-II 1 set
EUR 450

Mouse Cytokine Primer Library II

MCA-II 1 set
EUR 450

Rat Cytokine Primer Library II

RCA-II 1 set
EUR 548

Human Colon Cancer Primer Library II

HCCP-II 1 set
EUR 548

Human DNA Repair Primer Library II

HDRL-II 1 set
EUR 548

Mouse DNA Repair Primer Library II

MDRL-II 1 set
EUR 645

Human Interferon Type II Signaling Primer Library

HIFN-II 1 set
EUR 548

Human Cancer Driver Gene II Primer Library

HCDG-II 1 set
EUR 645

220V Voltage Transformer

2322106 unit
EUR 100

FastHyb-Hybridization Solution

L1031250 250 ml
EUR 249
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

WSC-2620 PowerBLOCK, 220V

4002621 1unit
EUR 1431
Description: H eat bl ock i ncubat or wi t h t emp cont r ol fuct i on

Gryphon Retroviral Expression System II

ABP-RVK-10002 1 set Ask for price
    • Product line: Cell Line Collection
    • Brand: Retroviral Packaging Cell Lines
Description: PRODUCT LINE DISCONTINUED. Please contact us.

Acd/ Rat Acd ELISA Kit

ELI-12109r 96 Tests
EUR 886

WSC-2630 PowerBLOCK Shaker, 220V

4002631 1unit
EUR 2873
Description: H eat bl ock i ncubat or wi t h t emp cont r ol and shak i ng fuct i on

ACD antibody

70R-2904 50 ug
EUR 467
Description: Rabbit polyclonal ACD antibody

ACD antibody

70R-3020 50 ug
EUR 467
Description: Rabbit polyclonal ACD antibody

ACD Antibody

46923-100ul 100ul
EUR 252

ACD Antibody

39459-100ul 100ul
EUR 390

ACD Antibody

46303-100ul 100ul
EUR 252

ACD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACD. Recognizes ACD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Acd antibody

70R-8190 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Acd antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT14590 2 ug
EUR 495

Hybridization cocktails I, 0% Formamide

HD0137 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Hybridization cocktails III, 0% Formamide

HD0143 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

Hybridization cocktails, IV 50% Formamide

HD0147 25ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Hybridization Buffers

WUV-M20, UV Transilluminator, 312nm, 220V

3532198 1unit
EUR 1627


402645 1/pk
EUR 1909
Description: Bioprocess Vessels; Spinner Accessories

myVolt™ Touch power supply, 220V

LE1010 Ea
EUR 718

ACD Rabbit pAb

A12177-100ul 100 ul
EUR 308

ACD Rabbit pAb

A12177-200ul 200 ul
EUR 459

ACD Rabbit pAb

A12177-20ul 20 ul
EUR 183

ACD Rabbit pAb

A12177-50ul 50 ul
EUR 223

ACD Blocking Peptide

33R-4573 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACD antibody, catalog no. 70R-2904

ACD Blocking Peptide

33R-8842 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACD antibody, catalog no. 70R-3020

Acd Blocking Peptide

33R-7345 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Acd antibody, catalog no. 70R-8190

ACD Conjugated Antibody

C46303 100ul
EUR 397

ACD Conjugated Antibody

C46923 100ul
EUR 397

ACD cloning plasmid

CSB-CL839289HU-10ug 10ug
EUR 567
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1635
  • Sequence: atgcctggccgctgtcagagtgacgccgcgatgagagtaaacgggccagcatcccgtgcaccagcggggtggaccagcgggagtctgcacacaggcccccgagcaggacgccctcgtgcgcaggcgcggggtgtacgtgggcggggcctcctcctccggccccgcccagcgaagg
  • Show more
Description: A cloning plasmid for the ACD gene.

ACD Polyclonal Antibody

A70067 100 ?g
EUR 628.55
Description: reagents widely cited

anti- ACD antibody

FNab00078 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: adrenocortical dysplasia homolog(Mouse)
  • Uniprot ID: Q96AP0
  • Gene ID: 65057
Description: Antibody raised against ACD

Anti-ACD antibody

PAab00078 100 ug
EUR 355

Anti-ACD antibody

STJ114070 100 µl
EUR 277
Description: This gene encodes a protein that is involved in telomere function. This protein is one of six core proteins in the telosome/shelterin telomeric complex, which functions to maintain telomere length and to protect telomere ends. Through its interaction with other components, this protein plays a key role in the assembly and stabilization of this complex, and it mediates the access of telomerase to the telomere. Multiple transcript variants encoding different isoforms have been found for this gene. This gene, which is also referred to as TPP1, is distinct from the unrelated TPP1 gene on chromosome 11, which encodes tripeptidyl-peptidase I.

Lung Dissociation System 8 (Alveolar type II), Rat

4-20318 ea Ask for price

ACD Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACD. Recognizes ACD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACD Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACD. Recognizes ACD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACD Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACD. Recognizes ACD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EHA0619 96Tests
EUR 521


EGTA0619 96Tests
EUR 521

Canine ACD ELISA Kit

ECA0619 96Tests
EUR 521

Anserini ACD ELISA Kit

EAA0619 96Tests
EUR 521

ACD HybEZ II Hybridization System 220v