HEXB recombinant protein

HEXB recombinant protein 

To Order Contact us: lieven@wlsolutions.be

Rat Hexosaminidase B Beta (HEXb) ELISA Kit

DLR-HEXb-Ra-96T 96T
EUR 661
  • Should the Rat Hexosaminidase B Beta (HEXb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hexosaminidase B Beta (HEXb) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hexosaminidase B Beta (HEXb) ELISA Kit

RDR-HEXb-Hu-48Tests 48 Tests
EUR 500

Human Hexosaminidase B Beta (HEXb) ELISA Kit

RDR-HEXb-Hu-96Tests 96 Tests
EUR 692

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit

RDR-HEXb-Mu-48Tests 48 Tests
EUR 511

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit

RDR-HEXb-Mu-96Tests 96 Tests
EUR 709

Rat Hexosaminidase B Beta (HEXb) ELISA Kit

RDR-HEXb-Ra-48Tests 48 Tests
EUR 534

Rat Hexosaminidase B Beta (HEXb) ELISA Kit

RDR-HEXb-Ra-96Tests 96 Tests
EUR 742

Human Hexosaminidase B Beta (HEXb) ELISA Kit

RD-HEXb-Hu-48Tests 48 Tests
EUR 478

Human Hexosaminidase B Beta (HEXb) ELISA Kit

RD-HEXb-Hu-96Tests 96 Tests
EUR 662

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit

RD-HEXb-Mu-48Tests 48 Tests
EUR 489

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit

RD-HEXb-Mu-96Tests 96 Tests
EUR 677

Rat Hexosaminidase B Beta (HEXb) ELISA Kit

RD-HEXb-Ra-48Tests 48 Tests
EUR 511

Rat Hexosaminidase B Beta (HEXb) ELISA Kit

RD-HEXb-Ra-96Tests 96 Tests
EUR 709

HEXB Recombinant Protein (Human)

RP014596 100 ug Ask for price

HEXB Recombinant Protein (Rat)

RP204479 100 ug Ask for price

HEXB Recombinant Protein (Mouse)

RP141353 100 ug Ask for price

Hexb/ Rat Hexb ELISA Kit

ELI-07643r 96 Tests
EUR 886

Recombinant Hexosaminidase B Beta (HEXb)

4-RPA637Hu01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07686
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.8kDa
  • Isoelectric Point: 5.4
Description: Recombinant Human Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)

4-RPA637Hu02
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07686
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.9kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)

4-RPA637Mu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20060
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)

4-RPA637Mu02
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20060
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)

4-RPA637Ra01
  • EUR 556.96
  • EUR 252.00
  • EUR 1813.60
  • EUR 671.20
  • EUR 1242.40
  • EUR 436.00
  • EUR 4384.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6AXR4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hexosaminidase B Beta expressed in: E.coli

HEXB antibody

70R-17725 50 ul
EUR 435
Description: Rabbit polyclonal HEXB antibody

HEXB antibody

70R-31568 100 ug
EUR 327
Description: Rabbit polyclonal HEXB antibody

HEXB Antibody

33657-100ul 100ul
EUR 252

HEXB Antibody

33657-50ul 50ul
EUR 187

HEXB Antibody

DF3074 200ul
EUR 304
Description: HEXB Antibody detects endogenous levels of total HEXB.

HEXB Antibody

CSB-PA224713-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

HEXB Antibody

CSB-PA224713-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

HEXB antibody

70R-51557 100 ul
EUR 244
Description: Purified Polyclonal HEXB antibody

HEXB Antibody

1-CSB-PA009172
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HEXB Antibody

1-CSB-PA010316GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HEXB Antibody

1-CSB-PA010316LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

HEXB siRNA

20-abx902452
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HEXB siRNA

20-abx919297
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HEXB siRNA

20-abx919298
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HEXB Antibody

ABD3074 100 ug
EUR 438

anti-HEXB

YF-PA12282 50 ug
EUR 363
Description: Mouse polyclonal to HEXB

Beta-Hexb/ Rat Beta- Hexb ELISA Kit

ELA-E8893r 96 Tests
EUR 886

Recombinant Streptococcus Pneumoniae hexB Protein (aa 1-649)

VAng-Ly1618-inquire inquire Ask for price
Description: Streptococcus Pneumoniae DNA mismatch repair protein hexB, partial, recombinant protein.

HEXB Blocking Peptide

DF3074-BP 1mg
EUR 195

HEXB Blocking Peptide

20-abx062132
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HEXB Conjugated Antibody

C33657 100ul
EUR 397

Polyclonal HEXB Antibody

AMM05333G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEXB . This antibody is tested and proven to work in the following applications:

HEXB cloning plasmid

CSB-CL010316HU-10ug 10ug
EUR 577
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1671
  • Sequence: atggagctgtgcgggctggggctgccccggccgcccatgctgctggcgctgctgttggcgacactgctggcggcgatgttggcgctgctgactcaggtggcgctggtggtgcaggtggcggaggcggctcgggccccgagcgtctcggccaagccggggccggcgctgtggcccc
  • Show more
Description: A cloning plasmid for the HEXB gene.

Hexb Polyclonal Antibody

ABP54731-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of Hexb from Human. This Hexb antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530

Hexb Polyclonal Antibody

ABP54731-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of Hexb from Human. This Hexb antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530

Hexb Polyclonal Antibody

ABP54731-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of Hexb from Human. This Hexb antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530

HEXB Polyclonal Antibody

A68559 100 ?g
EUR 628.55
Description: fast delivery possible

HEXB Rabbit pAb

A1916-100ul 100 ul
EUR 308

HEXB Rabbit pAb

A1916-200ul 200 ul
EUR 459

HEXB Rabbit pAb

A1916-20ul 20 ul
EUR 183

HEXB Rabbit pAb

A1916-50ul 50 ul
EUR 223

anti- HEXB antibody

FNab03844 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: hexosaminidase B(beta polypeptide)
  • Uniprot ID: P07686
  • Gene ID: 3074
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against HEXB

Hexb Polyclonal Antibody

ES5730-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Hexb from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Hexb Polyclonal Antibody

ES5730-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Hexb from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-HEXB antibody

PAab03844 100 ug
EUR 355

Anti-HEXB Antibody

PB9211 100ug/vial
EUR 334

Anti-HEXB antibody

STJ28121 100 µl
EUR 277
Description: Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Hexb antibody

STJ93493 200 µl
EUR 197
Description: Rabbit polyclonal to Hexb.

Human Hexosaminidase B Beta (HEXb) Protein

20-abx167133
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Hexosaminidase B Beta (HEXb) Protein

20-abx168653
  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Hexosaminidase B Beta (HEXb) Protein

20-abx067093
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Hexosaminidase B Beta (HEXb) Protein

20-abx067094
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Hexosaminidase B Beta (HEXb) Protein

20-abx067095
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human HEXB ELISA Kit

ELA-E8893h 96 Tests
EUR 824

HEXB ELISA KIT|Human

EF006453 96 Tests
EUR 689

Rat HEXB shRNA Plasmid

20-abx988714
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HEXB Antibody, HRP conjugated

1-CSB-PA010316LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HEXB Antibody, FITC conjugated

1-CSB-PA010316LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HEXB Antibody, Biotin conjugated

1-CSB-PA010316LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal HEXB Antibody (Center)

AMM05335G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEXB (Center). This antibody is tested and proven to work in the following applications:

Human HEXB shRNA Plasmid

20-abx952094
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HEXB shRNA Plasmid

20-abx970785
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HEXB Protein Vector (Rat) (pPB-C-His)

PV272642 500 ng
EUR 603

HEXB Protein Vector (Rat) (pPB-N-His)

PV272643 500 ng
EUR 603

HEXB Protein Vector (Rat) (pPM-C-HA)

PV272644 500 ng
EUR 603

HEXB Protein Vector (Rat) (pPM-C-His)

PV272645 500 ng
EUR 603

HEXB Protein Vector (Mouse) (pPB-C-His)

PV188474 500 ng
EUR 603

HEXB Protein Vector (Mouse) (pPB-N-His)

PV188475 500 ng
EUR 603

HEXB Protein Vector (Mouse) (pPM-C-HA)

PV188476 500 ng
EUR 603

HEXB Protein Vector (Mouse) (pPM-C-His)

PV188477 500 ng
EUR 603

HEXB Protein Vector (Human) (pPB-C-His)

PV019461 500 ng
EUR 329

HEXB Protein Vector (Human) (pPB-N-His)

PV019462 500 ng
EUR 329

HEXB Protein Vector (Human) (pPM-C-HA)

PV019463 500 ng
EUR 329

HEXB Protein Vector (Human) (pPM-C-His)

PV019464 500 ng
EUR 329

Hexosaminidase B Beta (HEXb) Antibody

20-abx102154
  • EUR 300.00
  • EUR 133.00
  • EUR 759.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody

20-abx102155
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody

20-abx102156
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hexosaminidase B Beta (HEXB) Antibody

20-abx113002
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hexosaminidase B Beta (HEXb) Antibody

20-abx128533
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody

20-abx131145
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody

20-abx172803
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hexosaminidase B Beta (HEXb) Antibody

20-abx172804
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

HEXB Colorimetric Cell-Based ELISA

EKC1671 100ul
EUR 572

HEXB recombinant protein