HEXB recombinant protein

HEXB recombinant protein 

To Order Contact us: lieven@wlsolutions.be

Rat Hexosaminidase B Beta (HEXb) ELISA Kit
DLR-HEXb-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Hexosaminidase B Beta (HEXb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hexosaminidase B Beta (HEXb) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hexosaminidase B Beta (HEXb) ELISA Kit
RD-HEXb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Hexosaminidase B Beta (HEXb) ELISA Kit
RD-HEXb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
RD-HEXb-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
RD-HEXb-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Hexosaminidase B Beta (HEXb) ELISA Kit
RD-HEXb-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Hexosaminidase B Beta (HEXb) ELISA Kit
RD-HEXb-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Hexosaminidase B Beta (HEXb) ELISA Kit
RDR-HEXb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Hexosaminidase B Beta (HEXb) ELISA Kit
RDR-HEXb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
RDR-HEXb-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
RDR-HEXb-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Hexosaminidase B Beta (HEXb) ELISA Kit
RDR-HEXb-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Hexosaminidase B Beta (HEXb) ELISA Kit
RDR-HEXb-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

HEXB Recombinant Protein (Human)
RP014596	ABM	100 ug	Ask for price

HEXB Recombinant Protein (Rat)
RP204479	ABM	100 ug	Ask for price

HEXB Recombinant Protein (Mouse)
RP141353	ABM	100 ug	Ask for price

Hexb/ Rat Hexb ELISA Kit
ELI-07643r	Lifescience Market	96 Tests	EUR 886

Recombinant Hexosaminidase B Beta (HEXb)
4-RPA637Hu01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07686 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.8kDa Isoelectric Point: 5.4
Description: Recombinant Human Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)
4-RPA637Hu02	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P07686 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.9kDa Isoelectric Point: 6.6
Description: Recombinant Human Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)
4-RPA637Mu01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20060 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)
4-RPA637Mu02	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P20060 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Hexosaminidase B Beta expressed in: E.coli

Recombinant Hexosaminidase B Beta (HEXb)
4-RPA637Ra01	Cloud-Clone	EUR 556.96 EUR 252.00 EUR 1813.60 EUR 671.20 EUR 1242.40 EUR 436.00 EUR 4384.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6AXR4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.1kDa Isoelectric Point: Inquire
Description: Recombinant Rat Hexosaminidase B Beta expressed in: E.coli

HEXB siRNA
20-abx902452	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HEXB siRNA
20-abx919297	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HEXB siRNA
20-abx919298	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HEXB antibody
70R-51557	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal HEXB antibody

HEXB antibody
70R-31568	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal HEXB antibody

HEXB Antibody
ABD3074	Lifescience Market	100 ug	EUR 438

HEXB Antibody
33657-100ul	SAB	100ul	EUR 252

HEXB Antibody
33657-50ul	SAB	50ul	EUR 187

HEXB antibody
70R-17725	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HEXB antibody

HEXB Antibody
DF3074	Affbiotech	200ul	EUR 304
Description: HEXB Antibody detects endogenous levels of total HEXB.

HEXB Antibody
CSB-PA224713-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

HEXB Antibody
CSB-PA224713-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

HEXB Antibody
1-CSB-PA009172	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HEXB Antibody
1-CSB-PA010316GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HEXB Antibody
1-CSB-PA010316LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

anti-HEXB
YF-PA12282	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to HEXB

Beta-Hexb/ Rat Beta- Hexb ELISA Kit
ELA-E8893r	Lifescience Market	96 Tests	EUR 886

Recombinant Streptococcus Pneumoniae hexB Protein (aa 1-649)
VAng-Ly1618-inquire	Creative Biolabs	inquire	Ask for price
Description: Streptococcus Pneumoniae DNA mismatch repair protein hexB, partial, recombinant protein.

Polyclonal HEXB Antibody
AMM05333G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEXB . This antibody is tested and proven to work in the following applications:

HEXB Conjugated Antibody
C33657	SAB	100ul	EUR 397

HEXB cloning plasmid
CSB-CL010316HU-10ug	Cusabio	10ug	EUR 577
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1671 Sequence: atggagctgtgcgggctggggctgccccggccgcccatgctgctggcgctgctgttggcgacactgctggcggcgatgttggcgctgctgactcaggtggcgctggtggtgcaggtggcggaggcggctcgggccccgagcgtctcggccaagccggggccggcgctgtggcccc Show more
Description: A cloning plasmid for the HEXB gene.

anti- HEXB antibody
FNab03844	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: hexosaminidase B(beta polypeptide) Uniprot ID: P07686 Gene ID: 3074 Research Area: Neuroscience, Metabolism
Description: Antibody raised against HEXB

Hexb Polyclonal Antibody
ES5730-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Hexb from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Hexb Polyclonal Antibody
ES5730-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Hexb from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

HEXB Blocking Peptide
20-abx062132	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Hexb Polyclonal Antibody
ABP54731-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530 Applications tips:
Description: A polyclonal antibody for detection of Hexb from Human. This Hexb antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530

Hexb Polyclonal Antibody
ABP54731-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530 Applications tips:
Description: A polyclonal antibody for detection of Hexb from Human. This Hexb antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530

Hexb Polyclonal Antibody
ABP54731-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530 Applications tips:
Description: A polyclonal antibody for detection of Hexb from Human. This Hexb antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Hexb at AA rangle: 450-530

HEXB Rabbit pAb
A1916-100ul	Abclonal	100 ul	EUR 308

HEXB Rabbit pAb
A1916-200ul	Abclonal	200 ul	EUR 459

HEXB Rabbit pAb
A1916-20ul	Abclonal	20 ul	EUR 183

HEXB Rabbit pAb
A1916-50ul	Abclonal	50 ul	EUR 223

HEXB Polyclonal Antibody
A68559	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

HEXB Blocking Peptide
DF3074-BP	Affbiotech	1mg	EUR 195

Anti-HEXB Antibody
PB9211	BosterBio	100ug/vial	EUR 334

Anti-HEXB antibody
PAab03844	Lifescience Market	100 ug	EUR 355

Anti-Hexb antibody
STJ93493	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Hexb.

Anti-HEXB antibody
STJ28121	St John's Laboratory	100 µl	EUR 277
Description: Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Human Hexosaminidase B Beta (HEXb) Protein
20-abx067093	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Hexosaminidase B Beta (HEXb) Protein
20-abx067094	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Hexosaminidase B Beta (HEXb) Protein
20-abx067095	Abbexa	EUR 732.00 EUR 286.00 EUR 2305.00 EUR 885.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Rat Hexosaminidase B Beta (HEXb) Protein
20-abx168653	Abbexa	EUR 773.00 EUR 300.00 EUR 2444.00 EUR 926.00 EUR 551.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Hexosaminidase B Beta (HEXb) Protein
20-abx167133	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Polyclonal HEXB Antibody (Center)
AMM05335G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEXB (Center). This antibody is tested and proven to work in the following applications:

Rat HEXB shRNA Plasmid
20-abx988714	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HEXB ELISA Kit
ELA-E8893h	Lifescience Market	96 Tests	EUR 824

HEXB ELISA KIT|Human
EF006453	Lifescience Market	96 Tests	EUR 689

Mouse HEXB shRNA Plasmid
20-abx970785	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HEXB shRNA Plasmid
20-abx952094	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HEXB Antibody, HRP conjugated
1-CSB-PA010316LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HEXB Antibody, FITC conjugated
1-CSB-PA010316LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HEXB Antibody, Biotin conjugated
1-CSB-PA010316LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HEXB. Recognizes HEXB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HEXB Protein Vector (Rat) (pPB-C-His)
PV272642	ABM	500 ng	EUR 603

HEXB Protein Vector (Rat) (pPB-N-His)
PV272643	ABM	500 ng	EUR 603

HEXB Protein Vector (Rat) (pPM-C-HA)
PV272644	ABM	500 ng	EUR 603

HEXB Protein Vector (Rat) (pPM-C-His)
PV272645	ABM	500 ng	EUR 603

HEXB Protein Vector (Human) (pPB-C-His)
PV019461	ABM	500 ng	EUR 329

HEXB Protein Vector (Human) (pPB-N-His)
PV019462	ABM	500 ng	EUR 329

HEXB Protein Vector (Human) (pPM-C-HA)
PV019463	ABM	500 ng	EUR 329

HEXB Protein Vector (Human) (pPM-C-His)
PV019464	ABM	500 ng	EUR 329

HEXB Protein Vector (Mouse) (pPB-C-His)
PV188474	ABM	500 ng	EUR 603

HEXB Protein Vector (Mouse) (pPB-N-His)
PV188475	ABM	500 ng	EUR 603

HEXB Protein Vector (Mouse) (pPM-C-HA)
PV188476	ABM	500 ng	EUR 603

HEXB Protein Vector (Mouse) (pPM-C-His)
PV188477	ABM	500 ng	EUR 603

Polyclonal HEXB Antibody (aa481-530)
AMM05334G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HEXB (aa481-530). This antibody is tested and proven to work in the following applications:

HEXB Colorimetric Cell-Based ELISA
EKC1671	BosterBio	100ul	EUR 572

Hexosaminidase B Beta (HEXB) Antibody
20-abx113002	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Hexosaminidase B Beta (HEXb) Antibody
20-abx128533	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody
20-abx131145	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody
20-abx102154	Abbexa	EUR 300.00 EUR 133.00 EUR 759.00 EUR 398.00 EUR 258.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody
20-abx102155	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexosaminidase B Beta (HEXb) Antibody
20-abx102156	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Hexosaminidase B Beta (HEXb) Antibody
20-abx172803	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Hexosaminidase B Beta (HEXb) Antibody
20-abx172804	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Hexosaminidase B Beta (HEXB) Antibody
20-abx324839	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Hexosaminidase B Beta (HEXB) Antibody
abx330568-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Hexosaminidase B Beta (HEXB) Antibody
20-abx334257	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

HEXB Polyclonal Antibody, HRP Conjugated
A68560	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

HEXB Polyclonal Antibody, FITC Conjugated
A68561	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

HEXB Polyclonal Antibody, Biotin Conjugated
A68562	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

HEXB ORF Vector (Human) (pORF)
ORF004866	ABM	1.0 ug DNA	EUR 95

Hexb ORF Vector (Rat) (pORF)
ORF068161	ABM	1.0 ug DNA	EUR 506

Hexb ORF Vector (Mouse) (pORF)
ORF047119	ABM	1.0 ug DNA	EUR 506

pECMV-Hexb-m-FLAG Plasmid
PVT15274	Lifescience Market	2 ug	EUR 325

HEXB ELISA Kit (Human) (OKAN04774)
OKAN04774	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

HEXB ELISA Kit (Rat) (OKAN06041)
OKAN06041	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.55 ng/mL

HEXB ELISA Kit (Human) (OKCD06608)
OKCD06608	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

HEXB ELISA Kit (Mouse) (OKCD06609)
OKCD06609	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

HEXB ELISA Kit (Rat) (OKCD06610)
OKCD06610	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Responsible for the degradation of GM2 gangliosides, and a variety of other molecules containing terminal N-acetyl hexosamines, in the brain and other tissues.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.55ng/mL

HEXB ELISA Kit (Pig) (OKCA02505)
OKCA02505	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Responsible for the degradation of GM2 gangliosides, and a variety of other molecules containing terminal N-acetyl hexosamines, in the brain and other tissues.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.039 mU/mL

HEXB ELISA Kit (Human) (OKEH01871)
OKEH01871	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Hexosaminidase B is the beta subunit of the lysosomal enzyme beta-hexosaminidase that, together with the cofactor GM2 activator protein, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. Beta-hexosaminidase is composed of two subunits, alpha and beta, which are encoded by separate genes. Both beta-hexosaminidase alpha and beta subunits are members of family 20 of glycosyl hydrolases. Mutations in the alpha or beta subunit genes lead to an accumulation of GM2 ganglioside in neurons and neurodegenerative disorders termed the GM2 gangliosidoses. Beta subunit gene mutations lead to Sandhoff disease (GM2-gangliosidosis type II). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/ml

HEXB ELISA Kit (Mouse) (OKEH01872)
OKEH01872	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Responsible for the degradation of GM2 gangliosides, and a variety of other molecules containing terminal N-acetyl hexosamines, in the brain and other tissues.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL

HEXB ELISA Kit (Rat) (OKEH03564)
OKEH03564	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Responsible for the degradation of GM2 gangliosides, and a variety of other molecules containing terminal N-acetyl hexosamines, in the brain and other tissues.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.782U/mL

HEXB sgRNA CRISPR Lentivector set (Human)
K0947801	ABM	3 x 1.0 ug	EUR 339

Beta-Hexosaminidase Subunit Beta (HEXB) Antibody
abx145988-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Beta-Hexosaminidase Subunit Beta (HEXB) Antibody
20-abx013366	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Beta-Hexosaminidase Subunit Beta (HEXB) Antibody
20-abx007501	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Hexosaminidase B Beta (HEXB) Antibody (HRP)
20-abx334836	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexosaminidase B Beta (HEXB) Antibody (FITC)
20-abx334837	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexosaminidase B Beta (HEXB) Antibody (Biotin)
20-abx334838	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Beta-Hexosaminidase Subunit Beta (HEXB) Antibody
abx233844-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Hexosaminidase B Beta (HEXb) Antibody (Biotin)
20-abx272020	Abbexa	EUR 425.00 EUR 230.00 EUR 1191.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Hexb sgRNA CRISPR Lentivector set (Mouse)
K3720901	ABM	3 x 1.0 ug	EUR 339

Hexb sgRNA CRISPR Lentivector set (Rat)
K6716601	ABM	3 x 1.0 ug	EUR 339

Human Hexosaminidase B Beta (HEXB) ELISA Kit
abx595702-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

HEXB sgRNA CRISPR Lentivector (Human) (Target 1)
K0947802	ABM	1.0 ug DNA	EUR 154

HEXB sgRNA CRISPR Lentivector (Human) (Target 2)
K0947803	ABM	1.0 ug DNA	EUR 154

HEXB sgRNA CRISPR Lentivector (Human) (Target 3)
K0947804	ABM	1.0 ug DNA	EUR 154

Rat Hexosaminidase B beta (HEXb) ELISA Kit
20-abx155630	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Hexosaminidase B beta (HEXb) ELISA Kit
20-abx154136	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hexosaminidase B beta (HEXb) ELISA Kit
20-abx151802	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Hexosaminidase B beta (HEXb) CLIA Kit
20-abx491805	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Hexosaminidase B beta (HEXb) CLIA Kit
20-abx491806	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Hexosaminidase B beta (HEXb) CLIA Kit
20-abx491807	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Hexb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3720902	ABM	1.0 ug DNA	EUR 154

Hexb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3720903	ABM	1.0 ug DNA	EUR 154

Hexb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3720904	ABM	1.0 ug DNA	EUR 154

Hexb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6716602	ABM	1.0 ug DNA	EUR 154

Hexb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6716603	ABM	1.0 ug DNA	EUR 154

Hexb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6716604	ABM	1.0 ug DNA	EUR 154

Hexosaminidase B Beta (HEXb) Polyclonal Antibody (Human)
4-PAA637Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEXb (Lys315~Tyr456) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexosaminidase B Beta (HEXb)

Hexosaminidase B Beta (HEXb) Polyclonal Antibody (Human)
4-PAA637Hu02	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEXb (Thr122~Ser311) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexosaminidase B Beta (HEXb)

Hexosaminidase B Beta (HEXb) Polyclonal Antibody (Mouse)
4-PAA637Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEXb (Pro101~Ile217) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexosaminidase B Beta (HEXb)

Hexosaminidase B Beta (HEXb) Polyclonal Antibody (Mouse)
4-PAA637Mu02	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEXb (Lys294~Tyr435) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Hexosaminidase B Beta (HEXb)

Hexosaminidase B Beta (HEXb) Polyclonal Antibody (Rat)
4-PAA637Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HEXb (Pro100~Ile216) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hexosaminidase B Beta (HEXb)

Human Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Human Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Human Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Human Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Human Hexosaminidase B Beta (HEXb) ELISA Kit
4-SEA637Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hexosaminidase B Beta elisa. Alternative names of the recognized antigen: Hex-B ENC-1AS HCC-7 Beta-N-acetylhexosaminidase subunit beta Cervical cancer proto-oncogene 7 protein N-acetyl-beta-glucosaminidase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Hexosaminidase B Beta (HEXb) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4391.16
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 449.27
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 598.96
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
SEA637Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2395.32
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Hexosaminidase B Beta (HEXb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Hexosaminidase B Beta (HEXb) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Hexosaminidase B Beta (HEXb) ELISA Kit
4-SEA637Mu	Cloud-Clone	EUR 4442.00 EUR 2346.00 EUR 599.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Hexosaminidase B Beta elisa. Alternative names of the recognized antigen: Hex-B ENC-1AS HCC-7 Beta-N-acetylhexosaminidase subunit beta Cervical cancer proto-oncogene 7 protein N-acetyl-beta-glucosaminidase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Hexosaminidase B Beta (HEXb) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

HEXB recombinant protein