Histoclear 1 gal

Histoclear 1 gal 

To Order Contact us: lieven@wlsolutions.be

Rat Galanin (GAL) ELISA Kit

DLR-GAL-Ra-48T 48T
EUR 528
  • Should the Rat Galanin (GAL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Galanin (GAL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Galanin (GAL) ELISA Kit

DLR-GAL-Ra-96T 96T
EUR 690
  • Should the Rat Galanin (GAL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Galanin (GAL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Galanin (GAL) ELISA Kit

RDR-GAL-Hu-48Tests 48 Tests
EUR 522

Human Galanin (GAL) ELISA Kit

RDR-GAL-Hu-96Tests 96 Tests
EUR 724

Rat Galanin (GAL) ELISA Kit

RDR-GAL-Ra-48Tests 48 Tests
EUR 558

Rat Galanin (GAL) ELISA Kit

RDR-GAL-Ra-96Tests 96 Tests
EUR 776

Human Galanin (GAL) ELISA Kit

RD-GAL-Hu-48Tests 48 Tests
EUR 500

Human Galanin (GAL) ELISA Kit

RD-GAL-Hu-96Tests 96 Tests
EUR 692

Rat Galanin (GAL) ELISA Kit

RD-GAL-Ra-48Tests 48 Tests
EUR 534

Rat Galanin (GAL) ELISA Kit

RD-GAL-Ra-96Tests 96 Tests
EUR 742

Human Galectin-3 (Gal-3) AssayMax ELISA Kit

EG3311-1 96 Well Plate
EUR 477

Human Galectin-4 (Gal-4) AssayMax ELISA Kit

EG3312-1 96 Well Plate
EUR 477

Gal/ Rat Gal ELISA Kit

ELI-03532r 96 Tests
EUR 886


EUR 207


EUR 675

GAL antibody

70R-10548 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GAL antibody

GAL Antibody

43673-100ul 100ul
EUR 252


abx098142-1ml 1 ml
EUR 398
  • Shipped within 5-10 working days.


  • EUR 314.00
  • EUR 189.00
  • 1000 mg
  • 101 mg
  • Shipped within 5-10 working days.


  • EUR 300.00
  • EUR 189.00
  • 1000 mg
  • 100 mg
  • Shipped within 5-10 working days.


BIO-37035 1g Ask for price

GAL Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GAL. Recognizes GAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


A2539-5000 5 g
EUR 218
Description: Substrate for ? - Galactosidase which produces a rich blue color that can easily be detectedvisually over background.Substrate of choice for blue/white selection of recombinant bacterial colonieswith the lac + genotype.


HY-15934 5g
EUR 215


HY-101422 100mg
EUR 1083


BB0083 1g
EUR 90.02
  • Product category: Culture Media/Indicators/Stains


BB1182 250mg
EUR 123.95
  • Product category: Culture Media/Indicators/Stains


M715241 500mg
EUR 202.25
  • Product category: Culture Media/Indicators/Stains


MB1136 250mg
EUR 70.01
  • Product category: Culture Media/Indicators/Stains

Human Galectin-1 (Gal-1) Antibody

30005-05111 150 ug
EUR 261


46-101-RF 1 g/pk
EUR 164
Description: Media Catalog; Classical Media

X-Gal (5-bromo-4-chloro-3-indolyl-beta-galactopyranoside): (1g)

10011-1 1G
EUR 152
Description: Minimum order quantity: 1 unit of 1G

beta-Gal antibody

22355-100ul 100ul
EUR 390

beta-Gal antibody

70R-12799 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal beta-Gal antibody

GAL Blocking Peptide

33R-5242 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GAL antibody, catalog no. 70R-10548

Galanin (GAL) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galanin (GAL) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody

abx038050-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Galanin (GAL) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Galanin (GAL) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

GAL Conjugated Antibody

C43673 100ul
EUR 397

Galanin (GAL) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galanin (GAL) Antibody

abx431276-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Galanin (GAL) Peptide

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

GAL cloning plasmid

CSB-CL009191HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atggcccgaggcagcgccctccttctcgcctccctcctcctcgccgcggccctttctgcctctgcggggctctggtcgccggccaaggaaaaacgaggctggaccctgaacagcgcgggctacctgctgggcccacatgccgttggcaaccacaggtcattcagcgacaagaatgg
  • Show more
Description: A cloning plasmid for the GAL gene.

GAL Rabbit pAb

A1991-100ul 100 ul
EUR 308

GAL Rabbit pAb

A1991-200ul 200 ul
EUR 459

GAL Rabbit pAb

A1991-20ul 20 ul
EUR 183

GAL Rabbit pAb

A1991-50ul 50 ul
EUR 223

Recombinant Galanin (GAL)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22466
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.0kDa
  • Isoelectric Point: 6.8
Description: Recombinant Human Galanin expressed in: E.coli

Recombinant Galanin (GAL)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P47212
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.5kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Galanin expressed in: E.coli

Recombinant Galanin (GAL)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10683
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.9kDa
  • Isoelectric Point: 6.2
Description: Recombinant Rat Galanin expressed in: E.coli

X-Gal, 1g

EUR 190

Anti-GAL antibody

STJ23742 100 µl
EUR 277
Description: This gene encodes a neuroendocrine peptide that is widely expressed in the central and peripheral nervous systems and also the gastrointestinal tract, pancreas, adrenal gland and urogenital tract. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Galanin has diverse physiological functions including nociception, feeding and energy homeostasis, osmotic regulation and water balance. GMAP has been demonstrated to possess antifungal activity and hypothesized to be part of the innate immune system.

Anti-GAL antibody

STJ72050 100 µg
EUR 359


MB1135 100mg
EUR 157.01
  • Product category: Culture Media/Indicators/Stains

Human Galectin-1 (Gal-1) Antibody (Biotin Conjugate)

30005-05121 150 ug
EUR 369

Ovalbumin peptide OVA (Gal d 2, 257-264) class I MHC molecule

AV-9315-1 1 mg
EUR 286

Ovalbumin peptide OVA (Gal d 2, 323-339) MHC class II peptide

AV-9320-1 1 mg
EUR 286

Core 1 beta 3-Gal-T1 (Recombinant)

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Beta-1, 3-Gal-T1 Polyclonal Antibody

ABP52748-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T1 from Human, Mouse. This Beta-1, 3-Gal-T1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110

Beta-1, 3-Gal-T1 Polyclonal Antibody

ABP52748-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T1 from Human, Mouse. This Beta-1, 3-Gal-T1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110

Beta-1, 3-Gal-T1 Polyclonal Antibody

ABP52748-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T1 from Human, Mouse. This Beta-1, 3-Gal-T1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110

Beta-1, 3-Gal-T4 Polyclonal Antibody

ABP52749-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T4 from Human. This Beta-1, 3-Gal-T4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230

Beta-1, 3-Gal-T4 Polyclonal Antibody

ABP52749-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T4 from Human. This Beta-1, 3-Gal-T4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230

Beta-1, 3-Gal-T4 Polyclonal Antibody

ABP52749-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T4 from Human. This Beta-1, 3-Gal-T4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230

Beta-1, 3-Gal-TL Polyclonal Antibody

ABP52750-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-TL from Human. This Beta-1, 3-Gal-TL antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500

Beta-1, 3-Gal-TL Polyclonal Antibody

ABP52750-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-TL from Human. This Beta-1, 3-Gal-TL antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500

Beta-1, 3-Gal-TL Polyclonal Antibody

ABP52750-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-TL from Human. This Beta-1, 3-Gal-TL antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500

Beta-1, 4-Gal-T5 Polyclonal Antibody

ABP52751-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T5 from Human, Mouse. This Beta-1, 4-Gal-T5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370

Beta-1, 4-Gal-T5 Polyclonal Antibody

ABP52751-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T5 from Human, Mouse. This Beta-1, 4-Gal-T5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370

Beta-1, 4-Gal-T5 Polyclonal Antibody

ABP52751-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T5 from Human, Mouse. This Beta-1, 4-Gal-T5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370

Beta-1, 4-Gal-T1 Polyclonal Antibody

ABP54516-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T1 from Human, Mouse. This Beta-1, 4-Gal-T1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1

Beta-1, 4-Gal-T1 Polyclonal Antibody

ABP54516-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T1 from Human, Mouse. This Beta-1, 4-Gal-T1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1

Beta-1, 4-Gal-T1 Polyclonal Antibody

ABP54516-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T1 from Human, Mouse. This Beta-1, 4-Gal-T1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1

Beta-1, 4-Gal-T3 Polyclonal Antibody

ABP56862-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T3 from Human, Mouse, Rat. This Beta-1, 4-Gal-T3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320

Beta-1, 4-Gal-T3 Polyclonal Antibody

ABP56862-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T3 from Human, Mouse, Rat. This Beta-1, 4-Gal-T3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320

Beta-1, 4-Gal-T3 Polyclonal Antibody

ABP56862-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T3 from Human, Mouse, Rat. This Beta-1, 4-Gal-T3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320

Beta-1, 4-Gal-T2 Polyclonal Antibody

ABP56863-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T2 from Human, Mouse. This Beta-1, 4-Gal-T2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2

Beta-1, 4-Gal-T2 Polyclonal Antibody

ABP56863-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T2 from Human, Mouse. This Beta-1, 4-Gal-T2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2

Beta-1, 4-Gal-T2 Polyclonal Antibody

ABP56863-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T2 from Human, Mouse. This Beta-1, 4-Gal-T2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2

Beta-1, 3-Gal-T2 Polyclonal Antibody

ABP56864-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T2 from Human, Mouse. This Beta-1, 3-Gal-T2 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430

Beta-1, 3-Gal-T2 Polyclonal Antibody

ABP56864-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T2 from Human, Mouse. This Beta-1, 3-Gal-T2 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430

Beta-1, 3-Gal-T2 Polyclonal Antibody

ABP56864-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T2 from Human, Mouse. This Beta-1, 3-Gal-T2 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430

Gal sgRNA CRISPR Lentivector (Rat) (Target 1)

K7624302 1.0 ug DNA
EUR 154

Gal sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3756102 1.0 ug DNA
EUR 154

GAL sgRNA CRISPR Lentivector (Human) (Target 1)

K0834002 1.0 ug DNA
EUR 154

Human Galanin (GAL) Antibody

35687-05111 150 ug
EUR 261

GAL-3 Monoclonal Antibody

42023-100ul 100ul
EUR 333

X-Gal (MBG, > 99 %)

406-501 1 g
EUR 74

X-Gal (MBG, > 99 %)

406-502 5 x1 g
EUR 224

X-Gal (MBG, > 99 %)

406-503 10 x1 g
EUR 394

GAL protein (His tag)

80R-2759 50 ug
EUR 322
Description: Purified recombinant GAL protein (His tag)

Rat Galanin (GAL) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Galanin (GAL) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Galanin (GAL) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.


EHG0040 96Tests
EUR 521


ELA-E1084h 96 Tests
EUR 824


EGTG0040 96Tests
EUR 521

Bovine GAL ELISA Kit

EBG0040 96Tests
EUR 521

Canine GAL ELISA Kit

ECG0040 96Tests
EUR 521

Chicken GAL ELISA Kit

ECKG0040 96Tests
EUR 521

Anserini GAL ELISA Kit

EAG0040 96Tests
EUR 521


ELI-03533d 96 Tests
EUR 928


EF002825 96 Tests
EUR 689

OVA Conjugated Galanin (GAL)

  • EUR 197.66
  • EUR 156.00
  • EUR 466.24
  • EUR 222.08
  • EUR 344.16
  • EUR 195.00
  • EUR 1015.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22466
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Galanin expressed in: chemical synthesis

Rat GAL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Galanin (GAL) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Galanin (GAL) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human GAL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GAL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EMG0040 96Tests
EUR 521


ERG0040 96Tests
EUR 521


ESG0040 96Tests
EUR 521

Rabbit GAL ELISA Kit

ERTG0040 96Tests
EUR 521

Monkey GAL ELISA Kit

EMKG0040 96Tests
EUR 521

Porcine GAL ELISA Kit

EPG0040 96Tests
EUR 521

pSV- Beta- Gal Plasmid

PVT1030 2 ug
EUR 325


PVT16597 2 ug
EUR 325

GAL Recombinant Protein (Human)

RP012835 100 ug Ask for price

GAL Recombinant Protein (Rat)

RP202127 100 ug Ask for price

GAL Recombinant Protein (Mouse)

RP135767 100 ug Ask for price

X-gal/IPTG Solution

X0322-010 10x1ml
EUR 142

Human Galectin-1 (Gal-1) AssayLite Antibody (FITC Conjugate)

30005-05141 150 ug
EUR 428

Human Galectin-1 (Gal-1) AssayLite Antibody (RPE Conjugate)

30005-05151 150 ug
EUR 428

Human Galectin-1 (Gal-1) AssayLite Antibody (APC Conjugate)

30005-05161 150 ug
EUR 428

Human Galectin-1 (Gal-1) AssayLite Antibody (PerCP Conjugate)

30005-05171 150 ug
EUR 471

Anti-B4GALT3/Beta 1 4 Gal T3 Antibody

A09618 100ul
EUR 397
Description: Rabbit Polyclonal B4GALT3/Beta 1 4 Gal T3 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-B3GALT2/Beta 1 3 Gal T2 Antibody

A14751 100ul
EUR 397
Description: Rabbit Polyclonal B3GALT2/Beta 1 3 Gal T2 Antibody. Validated in IF, IHC and tested in Human, Mouse.

Anti-B4GALT1/Beta 1 4 Gal T1 Antibody

A03993 100ul
EUR 397
Description: Rabbit Polyclonal B4GALT1/Beta 1 4 Gal T1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-B4GALT3/Beta 1 4 Gal T3 Antibody

A30573 100ul
EUR 397
Description: Rabbit Polyclonal B4GALT3/Beta 1 4 Gal T3 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Human ?-galactosidase,?GAL ELISA Kit

201-12-0826 96 tests
EUR 440
  • This alpha -galactosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-galactosidase,?GAL ELISA Kit

201-12-0857 96 tests
EUR 440
  • This ?-galactosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human galanin,GAL ELISA Kit

201-12-1333 96 tests
EUR 440
  • This galanin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-galactosyle,?-Gal ELISA Kit

201-12-1465 96 tests
EUR 440
  • This alpha -galactosyle ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

E. coli β-gal peptide

DAG2441 0.05 mg
EUR 485

Human Galanin (GAL) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Galanin (GAL) CLIA Kit

  • EUR 8443.00
  • EUR 4497.00
  • EUR 1036.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Galanin (GAL) CLIA Kit

abx196675-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Galanin (GAL) CLIA Kit

abx196967-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

D-Galactose (D-Gal) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Rat Galanin (GAL) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Galanin (GAL) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Galanin (GAL) ELISA Kit

abx254866-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Galanin (GAL) ELISA Kit

abx256413-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Galanin (GAL) ELISA Kit

abx250475-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human α-GAL ELISA Kit

EHAF0012 96Tests
EUR 521

Human α-Gal ELISA Kit

EHAF0013 96Tests
EUR 521

Human α-Gal ELISA Kit

EHG0041 96Tests
EUR 521

Human Gal-65 ELISA Kit

EHG0309 96Tests
EUR 521

Guinea Pig GAL ELISA Kit

EGG0040 96Tests
EUR 521

Goat α-GAL ELISA Kit

EGTAF0012 96Tests
EUR 521

Goat α-Gal ELISA Kit

EGTAF0013 96Tests
EUR 521

Goat α-Gal ELISA Kit

EGTG0041 96Tests
EUR 521

Goat Gal-65 ELISA Kit

EGTG0309 96Tests
EUR 521

Bovine α-GAL ELISA Kit

EBAF0012 96Tests
EUR 521

Bovine α-Gal ELISA Kit

EBAF0013 96Tests
EUR 521

Bovine α-Gal ELISA Kit

EBG0041 96Tests
EUR 521

Bovine Gal-65 ELISA Kit

EBG0309 96Tests
EUR 521

Canine α-GAL ELISA Kit

ECAF0012 96Tests
EUR 521

Canine α-Gal ELISA Kit

ECAF0013 96Tests
EUR 521

Canine α-Gal ELISA Kit

ECG0041 96Tests
EUR 521

Canine Gal-65 ELISA Kit

ECG0309 96Tests
EUR 521

Histoclear 1 gal