Histoclear 1 gal

Histoclear 1 gal 

To Order Contact us: lieven@wlsolutions.be

Rat Galanin (GAL) ELISA Kit
DLR-GAL-Ra-48T 48T
EUR 528
  • Should the Rat Galanin (GAL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Galanin (GAL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Galanin (GAL) ELISA Kit
DLR-GAL-Ra-96T 96T
EUR 690
  • Should the Rat Galanin (GAL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Galanin (GAL) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Galanin (GAL) ELISA Kit
RD-GAL-Hu-48Tests 48 Tests
EUR 500

Human Galanin (GAL) ELISA Kit
RD-GAL-Hu-96Tests 96 Tests
EUR 692

Rat Galanin (GAL) ELISA Kit
RD-GAL-Ra-48Tests 48 Tests
EUR 534

Rat Galanin (GAL) ELISA Kit
RD-GAL-Ra-96Tests 96 Tests
EUR 742

Human Galanin (GAL) ELISA Kit
RDR-GAL-Hu-48Tests 48 Tests
EUR 522

Human Galanin (GAL) ELISA Kit
RDR-GAL-Hu-96Tests 96 Tests
EUR 724

Rat Galanin (GAL) ELISA Kit
RDR-GAL-Ra-48Tests 48 Tests
EUR 558

Rat Galanin (GAL) ELISA Kit
RDR-GAL-Ra-96Tests 96 Tests
EUR 776

Human Galectin-3 (Gal-3) AssayMax ELISA Kit
EG3311-1 96 Well Plate
EUR 477

Human Galectin-4 (Gal-4) AssayMax ELISA Kit
EG3312-1 96 Well Plate
EUR 477

Gal/ Rat Gal ELISA Kit
ELI-03532r 96 Tests
EUR 886

GAL siRNA
20-abx902089
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

X-GAL
BIO-37035 1g Ask for price

X-Gal
BB0083 1g
EUR 90.02
  • Product category: Culture Media/Indicators/Stains

Bluo-Gal
BB1182 250mg
EUR 123.95
  • Product category: Culture Media/Indicators/Stains

GAL-021
HY-101422 100mg
EUR 1083

X-GAL
HY-15934 5g
EUR 215

X-gal
20-abx082320
  • EUR 314.00
  • EUR 189.00
  • 1000 mg
  • 101 mg
  • Shipped within 5-10 working days.

X-gal
20-abx082535
  • EUR 300.00
  • EUR 189.00
  • 1000 mg
  • 100 mg
  • Shipped within 5-10 working days.

X-gal
abx098142-1ml 1 ml
EUR 398
  • Shipped within 5-10 working days.

GAL siRNA
20-abx917561
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GAL siRNA
20-abx917562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

X-Gal
A2539-5000 5 g
EUR 218
Description: Substrate for ? - Galactosidase which produces a rich blue color that can easily be detectedvisually over background.Substrate of choice for blue/white selection of recombinant bacterial colonieswith the lac + genotype.

GAL Antibody
43673-100ul 100ul
EUR 252

X-GAL
2671-1G
EUR 207

X-GAL
2671-5G
EUR 675

GAL antibody
70R-10548 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GAL antibody

GAL Antibody
1-CSB-PA009191ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GAL. Recognizes GAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MU-Gal
MB1136 250mg
EUR 70.01
  • Product category: Culture Media/Indicators/Stains

Magenta-Gal
M715241 500mg
EUR 202.25
  • Product category: Culture Media/Indicators/Stains

Human Galectin-1 (Gal-1) Antibody
30005-05111 150 ug
EUR 261

1 G X-GAL, POWDER
46-101-RF 1 g/pk
EUR 164
Description: Media Catalog; Classical Media

X-Gal (5-bromo-4-chloro-3-indolyl-beta-galactopyranoside): (1g)
10011-1 1G
EUR 152
Description: Minimum order quantity: 1 unit of 1G

GAL Conjugated Antibody
C43673 100ul
EUR 397

GAL cloning plasmid
CSB-CL009191HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atggcccgaggcagcgccctccttctcgcctccctcctcctcgccgcggccctttctgcctctgcggggctctggtcgccggccaaggaaaaacgaggctggaccctgaacagcgcgggctacctgctgggcccacatgccgttggcaaccacaggtcattcagcgacaagaatgg
  • Show more
Description: A cloning plasmid for the GAL gene.

Galanin (GAL) Antibody
20-abx130269
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody
abx038050-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Galanin (GAL) Antibody
20-abx100095
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody
20-abx100096
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody
20-abx006277
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galanin (GAL) Antibody
20-abx172502
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Galanin (GAL) Antibody
20-abx172503
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Galanin (GAL) Antibody
20-abx320287
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Galanin (GAL) Antibody
abx431276-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Galanin (GAL) Peptide
20-abx262606
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

GAL Rabbit pAb
A1991-100ul 100 ul
EUR 308

GAL Rabbit pAb
A1991-200ul 200 ul
EUR 459

GAL Rabbit pAb
A1991-20ul 20 ul
EUR 183

GAL Rabbit pAb
A1991-50ul 50 ul
EUR 223

GAL Blocking Peptide
33R-5242 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GAL antibody, catalog no. 70R-10548

beta-Gal antibody
22355-100ul 100ul
EUR 390

beta-Gal antibody
70R-12799 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal beta-Gal antibody

MU-alpha-GAL
MB1135 100mg
EUR 157.01
  • Product category: Culture Media/Indicators/Stains

Recombinant Galanin (GAL)
4-RPB084Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22466
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.0kDa
  • Isoelectric Point: 6.8
Description: Recombinant Human Galanin expressed in: E.coli

Recombinant Galanin (GAL)
4-RPB084Mu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P47212
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.5kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Galanin expressed in: E.coli

Recombinant Galanin (GAL)
4-RPB084Ra01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10683
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.9kDa
  • Isoelectric Point: 6.2
Description: Recombinant Rat Galanin expressed in: E.coli

X-Gal, 1g
R7240-1g
EUR 190

Anti-GAL antibody
STJ72050 100 µg
EUR 359

Anti-GAL antibody
STJ23742 100 µl
EUR 277
Description: This gene encodes a neuroendocrine peptide that is widely expressed in the central and peripheral nervous systems and also the gastrointestinal tract, pancreas, adrenal gland and urogenital tract. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Galanin has diverse physiological functions including nociception, feeding and energy homeostasis, osmotic regulation and water balance. GMAP has been demonstrated to possess antifungal activity and hypothesized to be part of the innate immune system.

Human Galectin-1 (Gal-1) Antibody (Biotin Conjugate)
30005-05121 150 ug
EUR 369

Ovalbumin peptide OVA (Gal d 2, 257-264) class I MHC molecule
AV-9315-1 1 mg
EUR 286

Ovalbumin peptide OVA (Gal d 2, 323-339) MHC class II peptide
AV-9320-1 1 mg
EUR 286

Core 1 beta 3-Gal-T1 (Recombinant)
20-abx073827
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Beta-1, 3-Gal-T1 Polyclonal Antibody
ABP52748-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T1 from Human, Mouse. This Beta-1, 3-Gal-T1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110

Beta-1, 3-Gal-T1 Polyclonal Antibody
ABP52748-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T1 from Human, Mouse. This Beta-1, 3-Gal-T1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110

Beta-1, 3-Gal-T1 Polyclonal Antibody
ABP52748-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T1 from Human, Mouse. This Beta-1, 3-Gal-T1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T1 at AA range: 30-110

Beta-1, 3-Gal-T4 Polyclonal Antibody
ABP52749-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T4 from Human. This Beta-1, 3-Gal-T4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230

Beta-1, 3-Gal-T4 Polyclonal Antibody
ABP52749-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T4 from Human. This Beta-1, 3-Gal-T4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230

Beta-1, 3-Gal-T4 Polyclonal Antibody
ABP52749-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T4 from Human. This Beta-1, 3-Gal-T4 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,3-Gal-T4 at AA range: 150-230

Beta-1, 3-Gal-TL Polyclonal Antibody
ABP52750-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-TL from Human. This Beta-1, 3-Gal-TL antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500

Beta-1, 3-Gal-TL Polyclonal Antibody
ABP52750-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-TL from Human. This Beta-1, 3-Gal-TL antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500

Beta-1, 3-Gal-TL Polyclonal Antibody
ABP52750-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-TL from Human. This Beta-1, 3-Gal-TL antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-TL at AA range: 420-500

Beta-1, 4-Gal-T5 Polyclonal Antibody
ABP52751-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T5 from Human, Mouse. This Beta-1, 4-Gal-T5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370

Beta-1, 4-Gal-T5 Polyclonal Antibody
ABP52751-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T5 from Human, Mouse. This Beta-1, 4-Gal-T5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370

Beta-1, 4-Gal-T5 Polyclonal Antibody
ABP52751-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T5 from Human, Mouse. This Beta-1, 4-Gal-T5 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T5 at AA range: 290-370

Beta-1, 4-Gal-T3 Polyclonal Antibody
ABP56862-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T3 from Human, Mouse, Rat. This Beta-1, 4-Gal-T3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320

Beta-1, 4-Gal-T3 Polyclonal Antibody
ABP56862-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T3 from Human, Mouse, Rat. This Beta-1, 4-Gal-T3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320

Beta-1, 4-Gal-T3 Polyclonal Antibody
ABP56862-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T3 from Human, Mouse, Rat. This Beta-1, 4-Gal-T3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human ?-1,4-Gal-T3 at AA range: 240-320

Beta-1, 4-Gal-T2 Polyclonal Antibody
ABP56863-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T2 from Human, Mouse. This Beta-1, 4-Gal-T2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2

Beta-1, 4-Gal-T2 Polyclonal Antibody
ABP56863-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T2 from Human, Mouse. This Beta-1, 4-Gal-T2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2

Beta-1, 4-Gal-T2 Polyclonal Antibody
ABP56863-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T2 from Human, Mouse. This Beta-1, 4-Gal-T2 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T2

Beta-1, 3-Gal-T2 Polyclonal Antibody
ABP56864-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T2 from Human, Mouse. This Beta-1, 3-Gal-T2 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430

Beta-1, 3-Gal-T2 Polyclonal Antibody
ABP56864-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T2 from Human, Mouse. This Beta-1, 3-Gal-T2 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430

Beta-1, 3-Gal-T2 Polyclonal Antibody
ABP56864-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 3-Gal-T2 from Human, Mouse. This Beta-1, 3-Gal-T2 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,3-Gal-T2 at AA range: 350-430

Beta-1, 4-Gal-T1 Polyclonal Antibody
ABP54516-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T1 from Human, Mouse. This Beta-1, 4-Gal-T1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1

Beta-1, 4-Gal-T1 Polyclonal Antibody
ABP54516-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T1 from Human, Mouse. This Beta-1, 4-Gal-T1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1

Beta-1, 4-Gal-T1 Polyclonal Antibody
ABP54516-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1
  • Applications tips:
Description: A polyclonal antibody for detection of Beta-1, 4-Gal-T1 from Human, Mouse. This Beta-1, 4-Gal-T1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human ?-1,4-Gal-T1

Gal sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3756102 1.0 ug DNA
EUR 154

GAL sgRNA CRISPR Lentivector (Human) (Target 1)
K0834002 1.0 ug DNA
EUR 154

Gal sgRNA CRISPR Lentivector (Rat) (Target 1)
K7624302 1.0 ug DNA
EUR 154

Rat GAL shRNA Plasmid
20-abx985308
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GAL ELISA Kit
EHG0040 96Tests
EUR 521

Human GAL ELISA Kit
ELA-E1084h 96 Tests
EUR 824

Goat GAL ELISA Kit
EGTG0040 96Tests
EUR 521

Canine GAL ELISA Kit
ECG0040 96Tests
EUR 521

Chicken GAL ELISA Kit
ECKG0040 96Tests
EUR 521

Bovine GAL ELISA Kit
EBG0040 96Tests
EUR 521

Anserini GAL ELISA Kit
EAG0040 96Tests
EUR 521

Canine GAL ELISA KIT
ELI-03533d 96 Tests
EUR 928

GAL ELISA KIT|Human
EF002825 96 Tests
EUR 689

Porcine GAL ELISA Kit
EPG0040 96Tests
EUR 521

Rat GAL ELISA Kit
ERG0040 96Tests
EUR 521

Rabbit GAL ELISA Kit
ERTG0040 96Tests
EUR 521

Sheep GAL ELISA Kit
ESG0040 96Tests
EUR 521

Mouse GAL ELISA Kit
EMG0040 96Tests
EUR 521

Monkey GAL ELISA Kit
EMKG0040 96Tests
EUR 521

Human Galanin (GAL) Protein
20-abx066722
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Galanin (GAL) Protein
20-abx066723
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Galanin (GAL) Protein
20-abx167579
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Galanin (GAL) Antibody (FITC)
20-abx273724
  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Galanin (GAL) Antibody (Biotin)
20-abx271843
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human GAL shRNA Plasmid
20-abx959505
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GAL protein (His tag)
80R-2759 50 ug
EUR 322
Description: Purified recombinant GAL protein (His tag)

Human Galanin (GAL) Antibody
35687-05111 150 ug
EUR 261

GAL-3 Monoclonal Antibody
42023-100ul 100ul
EUR 333

X-Gal (MBG, > 99 %)
406-501 1 g
EUR 74

X-Gal (MBG, > 99 %)
406-502 5 x1 g
EUR 224

X-Gal (MBG, > 99 %)
406-503 10 x1 g
EUR 394

Mouse GAL shRNA Plasmid
20-abx970453
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OVA Conjugated Galanin (GAL)
4-CPB084Hu21
  • EUR 197.66
  • EUR 156.00
  • EUR 466.24
  • EUR 222.08
  • EUR 344.16
  • EUR 195.00
  • EUR 1015.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P22466
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Galanin expressed in: chemical synthesis

GAL Recombinant Protein (Human)
RP012835 100 ug Ask for price

pSV- Beta- Gal Plasmid
PVT1030 2 ug
EUR 325

pCMV-SPORT6-GAL Plasmid
PVT16597 2 ug
EUR 325

GAL Recombinant Protein (Rat)
RP202127 100 ug Ask for price

GAL Recombinant Protein (Mouse)
RP135767 100 ug Ask for price

X-gal/IPTG Solution
X0322-010 10x1ml
EUR 142

Human Galectin-1 (Gal-1) AssayLite Antibody (FITC Conjugate)
30005-05141 150 ug
EUR 428

Human Galectin-1 (Gal-1) AssayLite Antibody (RPE Conjugate)
30005-05151 150 ug
EUR 428

Human Galectin-1 (Gal-1) AssayLite Antibody (APC Conjugate)
30005-05161 150 ug
EUR 428

Human Galectin-1 (Gal-1) AssayLite Antibody (PerCP Conjugate)
30005-05171 150 ug
EUR 471

Anti-B4GALT1/Beta 1 4 Gal T1 Antibody
A03993 100ul
EUR 397
Description: Rabbit Polyclonal B4GALT1/Beta 1 4 Gal T1 Antibody. Validated in WB and tested in Human, Mouse.

Anti-B4GALT3/Beta 1 4 Gal T3 Antibody
A09618 100ul
EUR 397
Description: Rabbit Polyclonal B4GALT3/Beta 1 4 Gal T3 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-B4GALT3/Beta 1 4 Gal T3 Antibody
A30573 100ul
EUR 397
Description: Rabbit Polyclonal B4GALT3/Beta 1 4 Gal T3 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-B3GALT2/Beta 1 3 Gal T2 Antibody
A14751 100ul
EUR 397
Description: Rabbit Polyclonal B3GALT2/Beta 1 3 Gal T2 Antibody. Validated in IF, IHC and tested in Human, Mouse.

Polyclonal Goat Anti-GAL Antibody
AMM04987G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GAL . This antibody is tested and proven to work in the following applications:

Human Galanin (GAL)CLIA Kit
CCB084Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL)CLIA Kit
CCB084Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL)CLIA Kit
CCB084Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL)CLIA Kit
CCB084Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL) CLIA Kit
4-CCB084Hu
  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Galanin Clia kit. Alternative names of the recognized antigen: GALN
  • GLNN
  • GMAP
  • Galanin Prepropeptide
  • Galanin-Message-Associated Peptide
Description: Competitive Inhibition chemiluminescent immunoassay for detection of Human Galanin (GAL)Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids

Rat Galanin (GAL)CLIA Kit
CCB084Ra-10x96wellstestplate 10x96-wells test plate
EUR 6119.04
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL)CLIA Kit
CCB084Ra-1x48wellstestplate 1x48-wells test plate
EUR 591.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL)CLIA Kit
CCB084Ra-1x96wellstestplate 1x96-wells test plate
EUR 802.24
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL)CLIA Kit
CCB084Ra-5x96wellstestplate 5x96-wells test plate
EUR 3310.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Chemiluminescent immunoassay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL) CLIA Kit
4-CCB084Ra
  • EUR 6170.00
  • EUR 3311.00
  • EUR 803.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Galanin Clia kit. Alternative names of the recognized antigen: GALN
  • GLNN
  • GMAP
  • Galanin Prepropeptide
  • Galanin-Message-Associated Peptide
Description: Competitive Inhibition chemiluminescent immunoassay for detection of Rat Galanin (GAL)Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids

Human Galanin (GAL) ELISA Kit
CEB084Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL) ELISA Kit
CEB084Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL) ELISA Kit
CEB084Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL) ELISA Kit
CEB084Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Galanin (GAL) ELISA Kit
4-CEB084Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Galanin elisa. Alternative names of the recognized antigen: GALN
  • GLNN
  • GMAP
  • Galanin Prepropeptide
  • Galanin-Message-Associated Peptide
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Galanin (GAL) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Galanin (GAL) ELISA Kit
CEB084Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL) ELISA Kit
CEB084Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL) ELISA Kit
CEB084Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL) ELISA Kit
CEB084Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Galanin (GAL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Galanin (GAL) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Rat Galanin (GAL) ELISA Kit
4-CEB084Ra
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Galanin elisa. Alternative names of the recognized antigen: GALN
  • GLNN
  • GMAP
  • Galanin Prepropeptide
  • Galanin-Message-Associated Peptide
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Galanin (GAL) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

GAL-3 Conjugated Monoclonal Antibody
C42023 100ul
EUR 397

Cow Galanin (GAL) ELISA Kit
abx515106-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Galanin (GAL) ELISA Kit
abx515108-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Galanin (GAL) ELISA Kit
abx574153-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Galanin (GAL) ELISA Kit
abx574161-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Galanin (GAL) Protein (OVA)
20-abx651202
  • EUR 286.00
  • EUR 203.00
  • EUR 648.00
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human α-GAL ELISA Kit
EHAF0012 96Tests
EUR 521

Human α-Gal ELISA Kit
EHAF0013 96Tests
EUR 521

Human α-Gal ELISA Kit
EHG0041 96Tests
EUR 521

Human Gal-65 ELISA Kit
EHG0309 96Tests
EUR 521

Guinea Pig GAL ELISA Kit
EGG0040 96Tests
EUR 521

Histoclear 1 gal