Pak1 siRNA/shRNA/RNAi

Pak1 siRNA/shRNA/RNAi 

To Order Contact us: lieven@wlsolutions.be

GeneGlide? RNAi Delivery Control
M1082-10
EUR 237

GeneGlide? RNAi Delivery Control
M1082-100
EUR 835

GeneGlide? RNAi Delivery Control
M1082-50
EUR 495

T7 RNAi Transcription Kit
TR102-01 25 rxn
EUR 256

T7 RNAi Transcription Kit
TR102-02 50 rxn
EUR 404

Pak1/ Rat Pak1 ELISA Kit
ELI-22009r 96 Tests
EUR 886

pAd/BLOCK-iT-DEST RNAi Gateway Vector
PVT12297 2 ug
EUR 1119

PAK1 antibody
20R-1502 100 ug
EUR 673
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
20R-2006 50 ug
EUR 281
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
20R-2330 50 ug
EUR 281
Description: Rabbit polyclonal PAK1 antibody

PAK1 Antibody
31287-100ul 100ul
EUR 252

PAK1 Antibody
31287-50ul 50ul
EUR 187

PAK1 antibody
70R-19095 50 ul
EUR 435
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-11714 100 ug
EUR 447
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-14101 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal PAK1 antibody

PAK1 Antibody
32709-100ul 100ul
EUR 252

PAK1 Antibody
3248-100
EUR 338

PAK1 antibody
38635-100ul 100ul
EUR 252

PAK1 Antibody
3908-100
EUR 370

PAK1 Antibody
3908-30T
EUR 146

PAK1 Antibody
1-CSB-PA003703
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

PAK1 Antibody
1-CSB-PA116147
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PAK1 Antibody
1-CSB-PA613382DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PAK1 Antibody
DF7009 200ul
EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
DF7247 200ul
EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
1-CSB-PA017404GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PAK1 Antibody
1-CSB-PA238998
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PAK1 antibody
70R-35904 100 ug
EUR 327
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-37596 100 ug
EUR 273
Description: Rabbit Polyclonal PAK1 antibody

PAK1 antibody
70R-32704 100 ug
EUR 327
Description: Rabbit polyclonal PAK1 antibody

PAK1 Antibody
AF6424 200ul
EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
1-CSB-PA020206
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

PAK1 Antibody
1-CSB-PA020209
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PAK1 Antibody
ABF6424 100 ug
EUR 438

PAK1 Antibody
ABD7009 100 ug
EUR 438

PAK1 Antibody
ABD7247 100 ug
EUR 438

anti-PAK1
YF-PA13606 50 ul
EUR 363
Description: Mouse polyclonal to PAK1

anti-PAK1
YF-PA13607 50 ug
EUR 363
Description: Mouse polyclonal to PAK1

anti-PAK1
YF-PA24298 50 ul
EUR 334
Description: Mouse polyclonal to PAK1

shRNA-H1 (Neg)-(blasticidin) lentivirus
H1(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-H1 (Neg)-(Puromycin) lentivirus
H1(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-U6 (Neg)-(blasticidin) lentivirus
U6(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-U6 (Neg)-(Puromycin) lentivirus
U6(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Bsd) lentivirus
H1(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Puro) lentivirus
H1(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( RFP-Bsd) lentivirus
H1(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1(Neg)-( RFP-Puro) lentivirus
H1(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Bsd) lentivirus
U6(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Puro) lentivirus
U6(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Bsd) lentivirus
U6(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Puro) lentivirus
U6(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

PAK1 Rabbit pAb
A0809-100ul 100 ul
EUR 308

PAK1 Rabbit pAb
A0809-200ul 200 ul
EUR 459

PAK1 Rabbit pAb
A0809-20ul 20 ul
EUR 183

PAK1 Rabbit pAb
A0809-50ul 50 ul
EUR 223

PAK1 Blocking Peptide
3908BP-50
EUR 153

Polyclonal PAK1 Antibody
APR02686G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

Polyclonal PAK1 Antibody
APR00393G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

Polyclonal PAK1 Antibody
APR00397G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

PAK1 Blocking Peptide
DF7009-BP 1mg
EUR 195

PAK1 Blocking Peptide
DF7247-BP 1mg
EUR 195

PAK1/2 antibody
70R-36867 100 ug
EUR 327
Description: Rabbit Polyclonal PAK1/2 antibody

PAK1 antibody (Thr212)
70R-37232 100 ug
EUR 349
Description: Rabbit Polyclonal PAK1 antibody (Thr212)

PAK1 antibody (Ser204)
70R-32703 100 ug
EUR 327
Description: Rabbit polyclonal PAK1 antibody (Ser204)

PAK1 (pS21) Antibody
abx217620-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx119244
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx121455
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx123911
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PAK1 Blocking Peptide
20-abx162637
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx011314-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PAK1 / 2 Antibody
20-abx012833
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx031946-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx031946-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PAK1 (pT423) Antibody
abx031974-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

PAK1 (pT423) Antibody
abx031974-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PAK1 Blocking Peptide
20-abx061638
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK1 /PAK2 Antibody
AF4763 200ul
EUR 376
Description: PAK1 /PAK2 Antibody detects endogenous levels of PAK1 /PAK2.

PAK1 Blocking Peptide
AF6424-BP 1mg
EUR 195

PAK1 Conjugated Antibody
C31287 100ul
EUR 397

PAK1 (pS199) Antibody
abx333234-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

PAK1 (pS204) Antibody
abx333235-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

PAK1 cloning plasmid
CSB-CL613382HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1638
  • Sequence: ATGTCAAATAACGGCCTAGACATTCAAGACAAACCCCCAGCCCCTCCGATGAGAAATACCAGCACTATGATTGGAGCCGGCAGCAAAGATGCTGGAACCCTAAACCATGGTTCTAAACCTCTGCCTCCAAACCCAGAGGAGAAGAAAAAGAAGGACCGATTTTACCGATCCATTT
  • Show more
Description: A cloning plasmid for the PAK1 gene.

PAK1 Rabbit pAb
A3279-100ul 100 ul
EUR 308

PAK1 Rabbit pAb
A3279-200ul 200 ul
EUR 459

PAK1 Rabbit pAb
A3279-20ul 20 ul
EUR 183

PAK1 Rabbit pAb
A3279-50ul 50 ul
EUR 223

PAK1 Rabbit mAb
A19608-100ul 100 ul
EUR 410

PAK1 Rabbit mAb
A19608-200ul 200 ul
EUR 571

PAK1 Rabbit mAb
A19608-20ul 20 ul
EUR 221

PAK1 Rabbit mAb
A19608-50ul 50 ul
EUR 287

PAK1 Rabbit pAb
A2554-100ul 100 ul
EUR 308

PAK1 Rabbit pAb
A2554-200ul 200 ul
EUR 459

PAK1 Rabbit pAb
A2554-20ul 20 ul
EUR 183

PAK1 Rabbit pAb
A2554-50ul 50 ul
EUR 223

PAK1 (pT212) Antibody
20-abx000238
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- PAK1 antibody
FNab06119 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: p21 protein (Cdc42/Rac)-activated kinase 1
  • Uniprot ID: Q13153
  • Gene ID: 5058
  • Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against PAK1

anti- PAK1 antibody
FNab06120 100µg
EUR 585
  • Immunogen: p21 protein(Cdc42/Rac)-activated kinase 1
  • Uniprot ID: Q13153
  • Gene ID: 5058
  • Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against PAK1

NVS-PAK1-1
HY-100519 5mg
EUR 187

Anti-PAK1 Antibody
PA1563 100ug/vial
EUR 294

Anti-PAK1 antibody
PAab06119 100 ug
EUR 355

Anti-PAK1 antibody
PAab06120 100 ug
EUR 412

Anti-PAK1 antibody
STJ24887 100 µl
EUR 277
Description: This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PAK1 antibody
STJ24888 100 µl
EUR 277
Description: This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PAK1 antibody
STJ114900 100 µl
EUR 277
Description: This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PAK1 antibody
STJ70976 100 µg
EUR 359

Anti-PAK1 (1E11)
YF-MA10654 100 ug
EUR 363
Description: Mouse monoclonal to PAK1

Anti-PAK1 (4D1)
YF-MA10655 100 ug
EUR 363
Description: Mouse monoclonal to PAK1

PAK1/PAK2/PAK3 antibody
20R-2015 50 ug
EUR 281
Description: Rabbit polyclonal PAK1/PAK2/PAK3 antibody

PAK1/PAK2/PAK3 antibody
20R-2337 50 ug
EUR 281
Description: Rabbit polyclonal PAK1/PAK2/PAK3 antibody

PAK1 (Ab-212) Antibody
21160-100ul 100ul
EUR 252

PAK1 (Ab-212) Antibody
21160-50ul 50ul
EUR 187

Pak1 siRNA/shRNA/RNAi