Pak1 siRNA/shRNA/RNAi

Pak1 siRNA/shRNA/RNAi 

To Order Contact us: lieven@wlsolutions.be

GeneGlide? RNAi Delivery Control
M1082-10	Biovision		EUR 237

GeneGlide? RNAi Delivery Control
M1082-100	Biovision		EUR 835

GeneGlide? RNAi Delivery Control
M1082-50	Biovision		EUR 495

T7 RNAi Transcription Kit
TR102-01	Vazyme	25 rxn	EUR 256

T7 RNAi Transcription Kit
TR102-02	Vazyme	50 rxn	EUR 404

Pak1/ Rat Pak1 ELISA Kit
ELI-22009r	Lifescience Market	96 Tests	EUR 886

pAd/BLOCK-iT-DEST RNAi Gateway Vector
PVT12297	Lifescience Market	2 ug	EUR 1119

PAK1 Antibody
31287-100ul	SAB	100ul	EUR 252

PAK1 Antibody
31287-50ul	SAB	50ul	EUR 187

PAK1 antibody
38635-100ul	SAB	100ul	EUR 252

PAK1 Antibody
32709-100ul	SAB	100ul	EUR 252

PAK1 Antibody
1-CSB-PA613382DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PAK1 Antibody
1-CSB-PA116147	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PAK1 Antibody
1-CSB-PA238998	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PAK1 Antibody
1-CSB-PA020206	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

PAK1 Antibody
1-CSB-PA020209	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PAK1 Antibody
1-CSB-PA017404GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PAK1 Antibody
1-CSB-PA003703	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

PAK1 Antibody
AF6424	Affbiotech	200ul	EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
DF7009	Affbiotech	200ul	EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
DF7247	Affbiotech	200ul	EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
ABD7009	Lifescience Market	100 ug	EUR 438

PAK1 Antibody
ABD7247	Lifescience Market	100 ug	EUR 438

PAK1 Antibody
ABF6424	Lifescience Market	100 ug	EUR 438

PAK1 Antibody
3248-100	Biovision		EUR 338

PAK1 Antibody
3908-100	Biovision		EUR 370

PAK1 Antibody
3908-30T	Biovision		EUR 146

anti-PAK1
YF-PA24298	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PAK1

anti-PAK1
YF-PA13606	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to PAK1

anti-PAK1
YF-PA13607	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to PAK1

PAK1 antibody
20R-2006	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
20R-2330	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
20R-1502	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-19095	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-37596	Fitzgerald	100 ug	EUR 273
Description: Rabbit Polyclonal PAK1 antibody

PAK1 antibody
70R-11714	Fitzgerald	100 ug	EUR 447
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-14101	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-32704	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-35904	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal PAK1 antibody

PAK1 Peptide
46-127P	ProSci	0.1 mg	EUR 338
Description: PAK1 Peptide

shRNA-H1 (Neg)-(blasticidin) lentivirus
H1(shRNA-Ctr)-Bsd	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-H1 (Neg)-(Puromycin) lentivirus
H1(shRNA-Ctr)-Puro	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-U6 (Neg)-(blasticidin) lentivirus
U6(shRNA-Ctr)-Bsd	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-U6 (Neg)-(Puromycin) lentivirus
U6(shRNA-Ctr)-Puro	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Bsd) lentivirus
H1(shRNA-Ctr)-GB	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Puro) lentivirus
H1(shRNA-Ctr)-GP	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( RFP-Bsd) lentivirus
H1(shRNA-Ctr)-RB	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1(Neg)-( RFP-Puro) lentivirus
H1(shRNA-Ctr)-RP	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Bsd) lentivirus
U6(shRNA-Ctr)-GB	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Puro) lentivirus
U6(shRNA-Ctr)-GP	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Bsd) lentivirus
U6(shRNA-Ctr)-RB	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Puro) lentivirus
U6(shRNA-Ctr)-RP	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

NVS-PAK1-1
HY-100519	MedChemExpress	5mg	EUR 187

Anti-PAK1 Antibody
PA1563	BosterBio	100ug/vial	EUR 294

PAK1 (pT212) Antibody
20-abx119244	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx121455	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx123911	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

PAK1 Rabbit pAb
A0809-100ul	Abclonal	100 ul	EUR 308

PAK1 Rabbit pAb
A0809-200ul	Abclonal	200 ul	EUR 459

PAK1 Rabbit pAb
A0809-20ul	Abclonal	20 ul	EUR 183

PAK1 Rabbit pAb
A0809-50ul	Abclonal	50 ul	EUR 223

PAK1 Blocking Peptide
20-abx061638	Abbexa	EUR 258.00 EUR 384.00	1 mg 5 mg
Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx011314-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

PAK1 / 2 Antibody
20-abx012833	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx000238	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx031946-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx031946-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

PAK1 (pT423) Antibody
abx031974-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

PAK1 (pT423) Antibody
abx031974-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

PAK1 Rabbit pAb
A3279-100ul	Abclonal	100 ul	EUR 308

PAK1 Rabbit pAb
A3279-200ul	Abclonal	200 ul	EUR 459

PAK1 Rabbit pAb
A3279-20ul	Abclonal	20 ul	EUR 183

PAK1 Rabbit pAb
A3279-50ul	Abclonal	50 ul	EUR 223

PAK1 Rabbit mAb
A19608-100ul	Abclonal	100 ul	EUR 410

PAK1 Rabbit mAb
A19608-200ul	Abclonal	200 ul	EUR 571

PAK1 Rabbit mAb
A19608-20ul	Abclonal	20 ul	EUR 221

PAK1 Rabbit mAb
A19608-50ul	Abclonal	50 ul	EUR 287

PAK1 Rabbit pAb
A2554-100ul	Abclonal	100 ul	EUR 308

PAK1 Rabbit pAb
A2554-200ul	Abclonal	200 ul	EUR 459

PAK1 Rabbit pAb
A2554-20ul	Abclonal	20 ul	EUR 183

PAK1 Rabbit pAb
A2554-50ul	Abclonal	50 ul	EUR 223

PAK1 (pS21) Antibody
abx217620-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

PAK1 Blocking Peptide
20-abx162637	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Anti-PAK1 antibody
STJ24887	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PAK1 antibody
STJ24888	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Polyclonal PAK1 Antibody
APR02686G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

Anti-PAK1 antibody
STJ70976	St John's Laboratory	100 µg	EUR 359

PAK1 (pS199) Antibody
abx333234-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

PAK1 (pS204) Antibody
abx333235-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Polyclonal PAK1 Antibody
APR00393G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

Polyclonal PAK1 Antibody
APR00397G	Leading Biology	0.1mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

Anti-PAK1 antibody
STJ114900	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

PAK1 cloning plasmid
CSB-CL613382HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1638 Sequence: ATGTCAAATAACGGCCTAGACATTCAAGACAAACCCCCAGCCCCTCCGATGAGAAATACCAGCACTATGATTGGAGCCGGCAGCAAAGATGCTGGAACCCTAAACCATGGTTCTAAACCTCTGCCTCCAAACCCAGAGGAGAAGAAAAAGAAGGACCGATTTTACCGATCCATTT Show more
Description: A cloning plasmid for the PAK1 gene.

anti- PAK1 antibody
FNab06119	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: p21 protein (Cdc42/Rac)-activated kinase 1 Uniprot ID: Q13153 Gene ID: 5058 Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against PAK1

anti- PAK1 antibody
FNab06120	FN Test	100µg	EUR 585
Immunogen: p21 protein(Cdc42/Rac)-activated kinase 1 Uniprot ID: Q13153 Gene ID: 5058 Research Area: Neuroscience, Cardiovascular, Metabolism
Description: Antibody raised against PAK1

Pak1 siRNA/shRNA/RNAi