Pak1 siRNA/shRNA/RNAi

Pak1 siRNA/shRNA/RNAi 

To Order Contact us: lieven@wlsolutions.be

GeneGlide? RNAi Delivery Control
M1082-10
EUR 237

GeneGlide? RNAi Delivery Control
M1082-100
EUR 835

GeneGlide? RNAi Delivery Control
M1082-50
EUR 495

T7 RNAi Transcription Kit
TR102-01 25 rxn
EUR 256

T7 RNAi Transcription Kit
TR102-02 50 rxn
EUR 404

Pak1/ Rat Pak1 ELISA Kit
ELI-22009r 96 Tests
EUR 886

pAd/BLOCK-iT-DEST RNAi Gateway Vector
PVT12297 2 ug
EUR 1119

PAK1 antibody
20R-1502 100 ug
EUR 673
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
20R-2006 50 ug
EUR 281
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
20R-2330 50 ug
EUR 281
Description: Rabbit polyclonal PAK1 antibody

PAK1 Antibody
31287-100ul 100ul
EUR 252

PAK1 Antibody
31287-50ul 50ul
EUR 187

PAK1 antibody
70R-19095 50 ul
EUR 435
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-11714 100 ug
EUR 447
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-14101 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal PAK1 antibody

PAK1 Antibody
32709-100ul 100ul
EUR 252

PAK1 Antibody
3248-100
EUR 338

PAK1 antibody
38635-100ul 100ul
EUR 252

PAK1 Antibody
3908-100
EUR 370

PAK1 Antibody
3908-30T
EUR 146

PAK1 Antibody
1-CSB-PA003703
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

PAK1 Antibody
1-CSB-PA116147
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

PAK1 Antibody
1-CSB-PA613382DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PAK1 Antibody
DF7009 200ul
EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
DF7247 200ul
EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
1-CSB-PA017404GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PAK1 Antibody
1-CSB-PA238998
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

PAK1 antibody
70R-35904 100 ug
EUR 327
Description: Rabbit polyclonal PAK1 antibody

PAK1 antibody
70R-37596 100 ug
EUR 273
Description: Rabbit Polyclonal PAK1 antibody

PAK1 antibody
70R-32704 100 ug
EUR 327
Description: Rabbit polyclonal PAK1 antibody

PAK1 Antibody
AF6424 200ul
EUR 304
Description: PAK1 Antibody detects endogenous levels of total PAK1.

PAK1 Antibody
1-CSB-PA020206
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

PAK1 Antibody
1-CSB-PA020209
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1. Recognizes PAK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PAK1 Antibody
ABF6424 100 ug
EUR 438

PAK1 Antibody
ABD7009 100 ug
EUR 438

PAK1 Antibody
ABD7247 100 ug
EUR 438

anti-PAK1
YF-PA13606 50 ul
EUR 363
Description: Mouse polyclonal to PAK1

anti-PAK1
YF-PA13607 50 ug
EUR 363
Description: Mouse polyclonal to PAK1

anti-PAK1
YF-PA24298 50 ul
EUR 334
Description: Mouse polyclonal to PAK1

shRNA-H1 (Neg)-(blasticidin) lentivirus
H1(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-H1 (Neg)-(Puromycin) lentivirus
H1(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-U6 (Neg)-(blasticidin) lentivirus
U6(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-U6 (Neg)-(Puromycin) lentivirus
U6(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Bsd) lentivirus
H1(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Puro) lentivirus
H1(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( RFP-Bsd) lentivirus
H1(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1(Neg)-( RFP-Puro) lentivirus
H1(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Bsd) lentivirus
U6(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Puro) lentivirus
U6(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Bsd) lentivirus
U6(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Puro) lentivirus
U6(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

PAK1 Rabbit pAb
A0809-100ul 100 ul
EUR 308

PAK1 Rabbit pAb
A0809-200ul 200 ul
EUR 459

PAK1 Rabbit pAb
A0809-20ul 20 ul
EUR 183

PAK1 Rabbit pAb
A0809-50ul 50 ul
EUR 223

PAK1 Blocking Peptide
3908BP-50
EUR 153

Polyclonal PAK1 Antibody
APR02686G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

Polyclonal PAK1 Antibody
APR00393G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

Polyclonal PAK1 Antibody
APR00397G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK1 . This antibody is tested and proven to work in the following applications:

PAK1 Blocking Peptide
DF7009-BP 1mg
EUR 195

PAK1 Blocking Peptide
DF7247-BP 1mg
EUR 195

PAK1/2 antibody
70R-36867 100 ug
EUR 327
Description: Rabbit Polyclonal PAK1/2 antibody

PAK1 antibody (Thr212)
70R-37232 100 ug
EUR 349
Description: Rabbit Polyclonal PAK1 antibody (Thr212)

PAK1 antibody (Ser204)
70R-32703 100 ug
EUR 327
Description: Rabbit polyclonal PAK1 antibody (Ser204)

PAK1 (pS21) Antibody
abx217620-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx119244
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx121455
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
20-abx123911
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PAK1 Blocking Peptide
20-abx162637
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx011314-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PAK1 / 2 Antibody
20-abx012833
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx031946-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

PAK1 (pT212) Antibody
abx031946-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PAK1 (pT423) Antibody
abx031974-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

PAK1 (pT423) Antibody
abx031974-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PAK1 Blocking Peptide
20-abx061638
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK1 /PAK2 Antibody
AF4763 200ul
EUR 376
Description: PAK1 /PAK2 Antibody detects endogenous levels of PAK1 /PAK2.

PAK1 Blocking Peptide
AF6424-BP 1mg
EUR 195

PAK1 Conjugated Antibody
C31287 100ul
EUR 397

PAK1 (pS199) Antibody
abx333234-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

PAK1 (pS204) Antibody
abx333235-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

PAK1 cloning plasmid
CSB-CL613382HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1638
  • Sequence: ATGTCAAATAACGGCCTAGACATTCAAGACAAACCCCCAGCCCCTCCGATGAGAAATACCAGCACTATGATTGGAGCCGGCAGCAAAGATGCTGGAACCCTAAACCATGGTTCTAAACCTCTGCCTCCAAACCCAGAGGAGAAGAAAAAGAAGGACCGATTTTACCGATCCATTT
  • Show more
Description: A cloning plasmid for the PAK1 gene.

PAK1 Rabbit pAb
A3279-100ul 100 ul
EUR 308

PAK1 Rabbit pAb
A3279-200ul 200 ul
EUR 459

PAK1 Rabbit pAb
A3279-20ul 20 ul
EUR 183

PAK1 Rabbit pAb
A3279-50ul 50 ul
EUR 223

PAK1 Rabbit mAb
A19608-100ul 100 ul
EUR 410

PAK1 Rabbit mAb
A19608-200ul 200 ul
EUR 571

PAK1 Rabbit mAb
A19608-20ul 20 ul
EUR 221

PAK1 Rabbit mAb
A19608-50ul 50 ul
EUR 287

PAK1 Rabbit pAb
A2554-100ul 100 ul
EUR 308

PAK1 Rabbit pAb
A2554-200ul 200 ul
EUR 459

PAK1 Rabbit pAb
A2554-20ul 20 ul
EUR 183

PAK1 Rabbit pAb
A2554-50ul 50 ul
EUR 223

PAK1 (pT212) Antibody
20-abx000238
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pak1 siRNA/shRNA/RNAi