Pak2 siRNA/shRNA/RNAi

Pak2 siRNA/shRNA/RNAi 

To Order Contact us: lieven@wlsolutions.be

Rat PAK2 shRNA Plasmid

20-abx985494
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PAK2 shRNA Plasmid

20-abx981322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PAK2 shRNA Plasmid

20-abx953363
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pROKII- RNAI Plasmid

PVT3202 2 ug
EUR 266

GeneGlide? RNAi Delivery Control

M1082-10
EUR 237

GeneGlide? RNAi Delivery Control

M1082-100
EUR 835

GeneGlide? RNAi Delivery Control

M1082-50
EUR 495

T7 RNAi Transcription Kit

TR102-01 25 rxn
EUR 256

T7 RNAi Transcription Kit

TR102-02 50 rxn
EUR 404

Pak2/ Rat Pak2 ELISA Kit

ELI-22010r 96 Tests
EUR 886

PAK2 Antibody

1-CSB-PA010537
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PAK2 Antibody

1-CSB-PA020229
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

PAK2 Antibody

1-CSB-PA020230
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

PAK2 Antibody

1-CSB-PA017406GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PAK2 Antibody

1-CSB-PA622641DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PAK2 Antibody

1-CSB-PA922459
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

PAK2 Antibody

1-CSB-PA552213
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

PAK2 Antibody

24441-100ul 100ul
EUR 390

PAK2 Antibody

24442-100ul 100ul
EUR 390

PAK2 Antibody

35863-100ul 100ul
EUR 252

PAK2 Antibody

49859-100ul 100ul
EUR 333

PAK2 Antibody

49859-50ul 50ul
EUR 239

PAK2 Antibody

BF0195 200ul
EUR 376
Description: PAK2 antibody detects endogenous levels of total PAK2.

anti-PAK2

YF-PA13608 50 ul
EUR 363
Description: Mouse polyclonal to PAK2

anti-PAK2

YF-PA13609 100 ug
EUR 403
Description: Rabbit polyclonal to PAK2

PAK2 Antibody

3443-100
EUR 316

PAK2 Antibody

3443-30T
EUR 146

PAK2 antibody

20R-1575 100 ug
EUR 597
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

10R-1807 100 ul
EUR 457
Description: Mouse monoclonal PAK2 antibody

PAK2 antibody

70R-19097 50 ul
EUR 435
Description: Rabbit polyclonal PAK2 antibody

PAK2 Antibody

3885-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: PAK2 Antibody: The p21-activated kinases (PAKs) are serine-threonine kinases that bind to the active forms of Cdc42 and Rac. They are divided into two groups, the first of which include PAK1, 2 and 3, and can be activated by Cdc42/Rac binding. Group 1 PAKs contain an autoinhibitory domain whose activity is regulated by Cdc42/Rac binding. The group 1 PAKs are known to be involved in cellular processes such as gene transcription, apoptosis, and cell morphology and motility. Much less is known about the second group, which includes PAK4, 5 and 6, and are not activated by Cdc42/Rac binding. Of the six PAK proteins, only PAK2 is ubiquitously expressed and cleaved by caspase-3. This cleavage removes the amino-terminal regulatory domain and generates a constitutively active kinase fragment. Recent experiments have shown that following cleavage, the active fragment is myristoylated and directed to the plasma membrane and membrane ruffles where it promotes cell death via increased signaling through the c-Jun N-terminal kinase pathway, but without compromising mitochondrial integrity.

PAK2 Antibody

3885-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: PAK2 Antibody: The p21-activated kinases (PAKs) are serine-threonine kinases that bind to the active forms of Cdc42 and Rac. They are divided into two groups, the first of which include PAK1, 2 and 3, and can be activated by Cdc42/Rac binding. Group 1 PAKs contain an autoinhibitory domain whose activity is regulated by Cdc42/Rac binding. The group 1 PAKs are known to be involved in cellular processes such as gene transcription, apoptosis, and cell morphology and motility. Much less is known about the second group, which includes PAK4, 5 and 6, and are not activated by Cdc42/Rac binding. Of the six PAK proteins, only PAK2 is ubiquitously expressed and cleaved by caspase-3. This cleavage removes the amino-terminal regulatory domain and generates a constitutively active kinase fragment. Recent experiments have shown that following cleavage, the active fragment is myristoylated and directed to the plasma membrane and membrane ruffles where it promotes cell death via increased signaling through the c-Jun N-terminal kinase pathway, but without compromising mitochondrial integrity.

PAK2 Antibody

3887-002mg 0.02 mg
EUR 171.82
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: PAK2 Antibody: The p21-activated kinases (PAKs) are serine-threonine kinases that bind to the active forms of Cdc42 and Rac. They are divided into two groups, the first of which include PAK1, 2 and 3, and can be activated by Cdc42/Rac binding. Group 1 PAKs contain an autoinhibitory domain whose activity is regulated by Cdc42/Rac binding. The group 1 PAKs are known to be involved in cellular processes such as gene transcription, apoptosis, and cell morphology and motility. Much less is known about the second group, which includes PAK4, 5 and 6, and are not activated by Cdc42/Rac binding. Of the six PAK proteins, only PAK2 is ubiquitously expressed and cleaved by caspase-3. This cleavage removes the amino-terminal regulatory domain and generates a constitutively active kinase fragment. Recent experiments have shown that following cleavage, the active fragment is myristoylated and directed to the plasma membrane and membrane ruffles where it promotes cell death via increased signaling through the c-Jun N-terminal kinase pathway, but without compromising mitochondrial integrity.

PAK2 Antibody

3887-01mg 0.1 mg
EUR 436.42
  • Optimal dilutions/concentrations should be determined by the end user. The information provided is a guideline for product use. This product is for research use only.
Description: PAK2 Antibody: The p21-activated kinases (PAKs) are serine-threonine kinases that bind to the active forms of Cdc42 and Rac. They are divided into two groups, the first of which include PAK1, 2 and 3, and can be activated by Cdc42/Rac binding. Group 1 PAKs contain an autoinhibitory domain whose activity is regulated by Cdc42/Rac binding. The group 1 PAKs are known to be involved in cellular processes such as gene transcription, apoptosis, and cell morphology and motility. Much less is known about the second group, which includes PAK4, 5 and 6, and are not activated by Cdc42/Rac binding. Of the six PAK proteins, only PAK2 is ubiquitously expressed and cleaved by caspase-3. This cleavage removes the amino-terminal regulatory domain and generates a constitutively active kinase fragment. Recent experiments have shown that following cleavage, the active fragment is myristoylated and directed to the plasma membrane and membrane ruffles where it promotes cell death via increased signaling through the c-Jun N-terminal kinase pathway, but without compromising mitochondrial integrity.

PAK2 Peptide

3885P 0.05 mg
EUR 164.75
Description: (CT) PAK2 peptide

PAK2 Peptide

3887P 0.05 mg
EUR 164.75
Description: (NT) PAK2 peptide

PAK2 antibody

70R-31506 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-32706 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-32708 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-32710 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-11828 100 ug
EUR 392
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-50168 100 ul
EUR 287
Description: Purified Polyclonal PAK2 antibody

shRNA-H1 (Neg)-(blasticidin) lentivirus

H1(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-H1 (Neg)-(Puromycin) lentivirus

H1(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-U6 (Neg)-(blasticidin) lentivirus

U6(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-U6 (Neg)-(Puromycin) lentivirus

U6(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

pAd/BLOCK-iT-DEST RNAi Gateway Vector

PVT12297 2 ug
EUR 1119

shRNA-H1 (Neg)-( GFP-Bsd) lentivirus

H1(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Puro) lentivirus

H1(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( RFP-Bsd) lentivirus

H1(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1(Neg)-( RFP-Puro) lentivirus

H1(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Bsd) lentivirus

U6(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Puro) lentivirus

U6(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Bsd) lentivirus

U6(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Puro) lentivirus

U6(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

PAK2 cloning plasmid

CSB-CL622641HU-10ug 10ug
EUR 551
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1575
  • Sequence: atgtctgataacggagaactggaagataagcctccagcacctcctgtgcgaatgagcagcaccatctttagcactggaggcaaagaccctttgtcagccaatcacagtttgaaacctttgccctctgttccagaagagaaaaagcccaggcataaaatcatctccatattctcag
  • Show more
Description: A cloning plasmid for the PAK2 gene.

Anti-PAK2 antibody

STJ29472 100 µl
EUR 277
Description: The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell.

Polyclonal PAK2 Antibody

APR00106G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK2 . This antibody is tested and proven to work in the following applications:

Anti-PAK2 antibody

STJ11100066 100 µl
EUR 413
Description: The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell.

Polyclonal PAK2 Antibody

APR06418G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK2 . This antibody is tested and proven to work in the following applications:

Polyclonal PAK2 Antibody

APR06419G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK2 . This antibody is tested and proven to work in the following applications:

PAK2 Blocking Peptide

20-abx061704
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK2 (pS20) Antibody

20-abx009830
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

PAK2 Rabbit mAb

A4553-100ul 100 ul
EUR 410

PAK2 Rabbit mAb

A4553-200ul 200 ul
EUR 571

PAK2 Rabbit mAb

A4553-20ul 20 ul
EUR 221

PAK2 Rabbit mAb

A4553-50ul 50 ul
EUR 287

PAK2 Rabbit pAb

A7333-100ul 100 ul
EUR 308

PAK2 Rabbit pAb

A7333-200ul 200 ul
EUR 459

PAK2 Rabbit pAb

A7333-20ul 20 ul
EUR 183

PAK2 Rabbit pAb

A7333-50ul 50 ul
EUR 223

PAK2 (pS197) Antibody

abx333096-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

PAK2 Conjugated Antibody

C35863 100ul
EUR 397

anti- PAK2 antibody

FNab06122 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: p21 protein (Cdc42/Rac)-activated kinase 2
  • Uniprot ID: Q13177
  • Gene ID: 5062
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PAK2

PAK2 Conjugated Antibody

C49859 100ul
EUR 397

PAK2 Blocking Peptide

BF0195-BP 1mg
EUR 195

anti-PAK2 (3B5)

LF-MA30296 100 ul
EUR 547
Description: Mouse Monoclonal to PAK2

PAK1 /PAK2 Antibody

AF4763 200ul
EUR 376
Description: PAK1 /PAK2 Antibody detects endogenous levels of PAK1 /PAK2.

Anti-PAK2 antibody

PAab06122 100 ug
EUR 412

Anti-PAK2 (1E1)

YF-MA14588 100 ug
EUR 363
Description: Mouse monoclonal to PAK2

PAK2 Blocking Peptide

3443BP-50
EUR 153

PAK2 Blocking Peptide

33R-10490 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK2 antibody, catalog no. 20R-1575

PAK2 Blocking Peptide

33R-10761 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK2 antibody, catalog no. 70R-11828

PAK2 antibody (Ser20)

70R-31505 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser20)

PAK2 antibody (Ser192)

70R-32705 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser192)

PAK2 antibody (Ser141)

70R-32707 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser141)

PAK2 antibody (Ser197)

70R-32709 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser197)

PAK2 (Ab-197) Antibody

CSB-PA827528-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-197). Recognizes PAK2 (Ab-197) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PAK2 (Ab-197) Antibody

CSB-PA827528-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-197). Recognizes PAK2 (Ab-197) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-PAK2 (S20) Antibody

1-CSB-PA010536
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK2 (S20). Recognizes Phospho-PAK2 (S20) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

PAK2 (Ab-192) Antibody

CSB-PA101227-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-192). Recognizes PAK2 (Ab-192) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PAK2 (Ab-192) Antibody

CSB-PA101227-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-192). Recognizes PAK2 (Ab-192) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PAK1/PAK2/PAK3 Antibody

1-CSB-PA020215
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1/PAK2/PAK3. Recognizes PAK1/PAK2/PAK3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PAK1/PAK2/PAK3 Antibody

1-CSB-PA020216
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK1/PAK2/PAK3. Recognizes PAK1/PAK2/PAK3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Phospho-PAK2 (S192) Antibody

1-CSB-PA020221
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK2 (S192). Recognizes Phospho-PAK2 (S192) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Phospho-PAK2 (S141) Antibody

1-CSB-PA020222
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK2 (S141). Recognizes Phospho-PAK2 (S141) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-PAK2 (S197) Antibody

1-CSB-PA020226
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK2 (S197). Recognizes Phospho-PAK2 (S197) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Pak2 siRNA/shRNA/RNAi