Pak2 siRNA/shRNA/RNAi

Pak2 siRNA/shRNA/RNAi 

To Order Contact us:

pROKII- RNAI Plasmid

PVT3202 2 ug
EUR 266

Mouse PAK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PAK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PAK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GeneGlide? RNAi Delivery Control

EUR 237

GeneGlide? RNAi Delivery Control

EUR 835

GeneGlide? RNAi Delivery Control

EUR 495

T7 RNAi Transcription Kit

TR102-01 25 rxn
EUR 256

T7 RNAi Transcription Kit

TR102-02 50 rxn
EUR 404

Pak2/ Rat Pak2 ELISA Kit

ELI-22010r 96 Tests
EUR 886

PAK2 Antibody

BF0195 200ul
EUR 376
Description: PAK2 antibody detects endogenous levels of total PAK2.

PAK2 antibody

70R-50168 100 ul
EUR 287
Description: Purified Polyclonal PAK2 antibody

PAK2 antibody

70R-32706 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-32708 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-32710 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-31506 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody

PAK2 Antibody

35863-100ul 100ul
EUR 252

PAK2 Antibody

EUR 316

PAK2 Antibody

EUR 146

PAK2 Antibody

49859-100ul 100ul
EUR 333

PAK2 Antibody

49859-50ul 50ul
EUR 239

PAK2 antibody

10R-1807 100 ul
EUR 457
Description: Mouse monoclonal PAK2 antibody

PAK2 Antibody

24441-100ul 100ul
EUR 390

PAK2 Antibody

24442-100ul 100ul
EUR 390

PAK2 antibody

20R-1575 100 ug
EUR 597
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-19097 50 ul
EUR 435
Description: Rabbit polyclonal PAK2 antibody

PAK2 antibody

70R-11828 100 ug
EUR 392
Description: Rabbit polyclonal PAK2 antibody

PAK2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

PAK2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PAK2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

PAK2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

PAK2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

PAK2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

PAK2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PAK2. Recognizes PAK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


YF-PA13608 50 ul
EUR 363
Description: Mouse polyclonal to PAK2


YF-PA13609 100 ug
EUR 403
Description: Rabbit polyclonal to PAK2

pAd/BLOCK-iT-DEST RNAi Gateway Vector

PVT12297 2 ug
EUR 1119

PAK1 /PAK2 Antibody

AF4763 200ul
EUR 376
Description: PAK1 /PAK2 Antibody detects endogenous levels of PAK1 /PAK2.

Polyclonal PAK2 Antibody

APR00106G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK2 . This antibody is tested and proven to work in the following applications:

PAK2 Conjugated Antibody

C49859 100ul
EUR 397

Polyclonal PAK2 Antibody

APR06418G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK2 . This antibody is tested and proven to work in the following applications:

Polyclonal PAK2 Antibody

APR06419G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK2 . This antibody is tested and proven to work in the following applications:

PAK2 Blocking Peptide

BF0195-BP 1mg
EUR 195

PAK2 Conjugated Antibody

C35863 100ul
EUR 397

anti- PAK2 antibody

FNab06122 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: p21 protein (Cdc42/Rac)-activated kinase 2
  • Uniprot ID: Q13177
  • Gene ID: 5062
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PAK2

PAK2 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK2 (pS20) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

PAK2 (pS197) Antibody

abx333096-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

PAK2 Rabbit mAb

A4553-100ul 100 ul
EUR 410

PAK2 Rabbit mAb

A4553-200ul 200 ul
EUR 571

PAK2 Rabbit mAb

A4553-20ul 20 ul
EUR 221

PAK2 Rabbit mAb

A4553-50ul 50 ul
EUR 287

PAK2 antibody (Ser192)

70R-32705 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser192)

PAK2 antibody (Ser141)

70R-32707 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser141)

PAK2 antibody (Ser197)

70R-32709 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser197)

PAK2 antibody (Ser20)

70R-31505 100 ug
EUR 327
Description: Rabbit polyclonal PAK2 antibody (Ser20)

PAK2 Rabbit pAb

A7333-100ul 100 ul
EUR 308

PAK2 Rabbit pAb

A7333-200ul 200 ul
EUR 459

PAK2 Rabbit pAb

A7333-20ul 20 ul
EUR 183

PAK2 Rabbit pAb

A7333-50ul 50 ul
EUR 223

PAK2 Blocking Peptide

33R-10490 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK2 antibody, catalog no. 20R-1575

PAK2 Blocking Peptide

33R-10761 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK2 antibody, catalog no. 70R-11828

PAK2 Blocking Peptide

EUR 153

PAK2 cloning plasmid

CSB-CL622641HU-10ug 10ug
EUR 551
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1575
  • Sequence: atgtctgataacggagaactggaagataagcctccagcacctcctgtgcgaatgagcagcaccatctttagcactggaggcaaagaccctttgtcagccaatcacagtttgaaacctttgccctctgttccagaagagaaaaagcccaggcataaaatcatctccatattctcag
  • Show more
Description: A cloning plasmid for the PAK2 gene.

Anti-PAK2 antibody

PAab06122 100 ug
EUR 412

anti-PAK2 (3B5)

LF-MA30296 100 ul
EUR 547
Description: Mouse Monoclonal to PAK2

Anti-PAK2 antibody

STJ29472 100 µl
EUR 277
Description: The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell.

Anti-PAK2 antibody

STJ11100066 100 µl
EUR 413
Description: The p21 activated kinases (PAK) are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. The PAK proteins are a family of serine/threonine kinases that serve as targets for the small GTP binding proteins, CDC42 and RAC1, and have been implicated in a wide range of biological activities. The protein encoded by this gene is activated by proteolytic cleavage during caspase-mediated apoptosis, and may play a role in regulating the apoptotic events in the dying cell.

Anti-PAK2 (1E1)

YF-MA14588 100 ug
EUR 363
Description: Mouse monoclonal to PAK2

shRNA-H1 (Neg)-(blasticidin) lentivirus

H1(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-H1 (Neg)-(Puromycin) lentivirus

H1(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-U6 (Neg)-(blasticidin) lentivirus

U6(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-U6 (Neg)-(Puromycin) lentivirus

U6(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Bsd) lentivirus

H1(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Puro) lentivirus

H1(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( RFP-Bsd) lentivirus

H1(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1(Neg)-( RFP-Puro) lentivirus

H1(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Bsd) lentivirus

U6(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Puro) lentivirus

U6(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Bsd) lentivirus

U6(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Puro) lentivirus

U6(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

Phospho-PAK2 (Ser20) Antibody

AF2381 200ul
EUR 304
Description: Phospho-PAK2 (Ser20) Antibody detects endogenous levels of PAK2.

PAK1 /PAK2 Blocking Peptide

AF4763-BP 1mg
EUR 195


EF001535 96 Tests
EUR 689

PAK2 (pS20) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Phospho- PAK2 (Ser20) Antibody

ABF3693 100 ug
EUR 438

PAK2 (Phospho- Ser141) Antibody

ABF9245 100 ug
EUR 438

PAK1 / PAK2 / PAK3 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PAK1 / PAK2 / PAK3 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PAK2 recombinant monoclonal antibody

A5588 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human PAK2 for WB, IHC, IF,ELISA

PAK2 (Phospho-Ser141) Antibody

12117-100ul 100ul
EUR 252

PAK2 (Phospho-Ser141) Antibody

12117-50ul 50ul
EUR 187

PAK2 (Phospho-Ser815) Antibody

13251-100ul 100ul
EUR 252

PAK2 (Phospho-Ser815) Antibody

13251-50ul 50ul
EUR 187

PAK2 (Phospho-Ser197) Antibody

11749-100ul 100ul
EUR 252

PAK2 (Phospho-Ser197) Antibody

11749-50ul 50ul
EUR 187

PAK2 (Ab-192) Antibody

33242-100ul 100ul
EUR 252

PAK2 (Ab-192) Antibody

33242-50ul 50ul
EUR 187

PAK2 (Ab-141) Antibody

33243-100ul 100ul
EUR 252

PAK2 (Ab-141) Antibody

33243-50ul 50ul
EUR 187

PAK2 (Ab-197) Antibody

33244-100ul 100ul
EUR 252

PAK2 (Ab-197) Antibody

33244-50ul 50ul
EUR 187

PAK1/PAK2/PAK3 antibody

20R-2015 50 ug
EUR 281
Description: Rabbit polyclonal PAK1/PAK2/PAK3 antibody

PAK1/PAK2/PAK3 antibody

20R-2337 50 ug
EUR 281
Description: Rabbit polyclonal PAK1/PAK2/PAK3 antibody

Phospho-PAK2 (Ser141) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK2 (Ser141). Recognizes Phospho-PAK2 (Ser141) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-PAK2 (Ser141) Antibody

CSB-PA951578-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK2 (Ser141). Recognizes Phospho-PAK2 (Ser141) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PAK2 (Ab-197) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-197). Recognizes PAK2 (Ab-197) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PAK2 (Ab-197) Antibody

CSB-PA827528-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-197). Recognizes PAK2 (Ab-197) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Phospho-PAK2 (S20) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK2 (S20). Recognizes Phospho-PAK2 (S20) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Phospho-PAK2 (Ser197) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK2 (Ser197). Recognizes Phospho-PAK2 (Ser197) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

Phospho-PAK2 (Ser197) Antibody

CSB-PA149930-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK2 (Ser197). Recognizes Phospho-PAK2 (Ser197) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

PAK2 (Ab-192) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-192). Recognizes PAK2 (Ab-192) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PAK2 (Ab-192) Antibody

CSB-PA101227-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PAK2 (Ab-192). Recognizes PAK2 (Ab-192) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Pak2 siRNA/shRNA/RNAi