Pak4 siRNA/shRNA/RNAi

Pak4 siRNA/shRNA/RNAi 

To Order Contact us:

pROKII- RNAI Plasmid

PVT3202 2 ug
EUR 266

Mouse PAK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PAK4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit

DLR-PAK4-Hu-48T 48T
EUR 517
  • Should the Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human p21 Protein Activated Kinase 4 (PAK4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit

DLR-PAK4-Hu-96T 96T
EUR 673
  • Should the Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human p21 Protein Activated Kinase 4 (PAK4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit

RD-PAK4-Hu-48Tests 48 Tests
EUR 521

Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit

RD-PAK4-Hu-96Tests 96 Tests
EUR 723

Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit

RDR-PAK4-Hu-48Tests 48 Tests
EUR 544

Human p21 Protein Activated Kinase 4 (PAK4) ELISA Kit

RDR-PAK4-Hu-96Tests 96 Tests
EUR 756

GeneGlide? RNAi Delivery Control

EUR 237

GeneGlide? RNAi Delivery Control

EUR 835

GeneGlide? RNAi Delivery Control

EUR 495

T7 RNAi Transcription Kit

TR102-01 25 rxn
EUR 256

T7 RNAi Transcription Kit

TR102-02 50 rxn
EUR 404

PAK4 antibody

70R-50787 100 ul
EUR 287
Description: Purified Polyclonal PAK4 antibody

PAK4, Active

EUR 370

PAK4 Antibody

ABD7078 100 ug
EUR 438

PAK4 Antibody

35447-100ul 100ul
EUR 390

PAK4 Antibody

35864-100ul 100ul
EUR 252

PAK4 antibody

38462-100ul 100ul
EUR 252

PAK4 Antibody

EUR 332

PAK4 Antibody

EUR 146

PAK4 protein

30R-2822 5 ug
EUR 503
Description: Purified recombinant Human PAK4 protein

PAK4 Antibody

24183-100ul 100ul
EUR 390

PAK4 antibody

20R-1576 100 ug
EUR 673
Description: Rabbit polyclonal PAK4 antibody

PAK4 antibody

70R-19098 50 ul
EUR 435
Description: Rabbit polyclonal PAK4 antibody

PAK4 antibody

70R-11829 100 ug
EUR 403
Description: Rabbit polyclonal PAK4 antibody

PAK4 Antibody

DF7078 200ul
EUR 304
Description: PAK4 Antibody detects endogenous levels of total PAK4.

PAK4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK4. Recognizes PAK4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.IHC:1/200-1/1000.ELISA:1/40000

PAK4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK4. Recognizes PAK4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PAK4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAK4. Recognizes PAK4 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000, IF:1:50-1:500

PAK4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PAK4. Recognizes PAK4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


YF-PA25539 50 ul
EUR 334
Description: Mouse polyclonal to PAK4

pAd/BLOCK-iT-DEST RNAi Gateway Vector

PVT12297 2 ug
EUR 1119

Polyclonal PAK4 Antibody

APR00107G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK4 . This antibody is tested and proven to work in the following applications:

PAK4 Conjugated Antibody

C38462 100ul
EUR 397

Polyclonal PAK4 Antibody

APR06312G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK4 . This antibody is tested and proven to work in the following applications:

PAK4 Conjugated Antibody

C35864 100ul
EUR 397

PAK4 cloning plasmid

CSB-CL017408HU1-10ug 10ug
EUR 607
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atgtttgggaagaggaagaagcgggtggagatctccgcgccgtccaacttcgagcaccgcgtgcacacgggcttcgaccagcacgagcagaagttcacggggctgccccgccagtggcagagcctgatcgaggagtcggctcgccggcccaagcccctcgtcgaccccgcctgca
  • Show more
Description: A cloning plasmid for the PAK4 gene.

PAK4 cloning plasmid

CSB-CL017408HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atgtttgggaagaggaagaagcgggtggagatctccgcgccgtccaacttcgagcaccgcgtgcacacgggcttcgaccagcacgagcagaagttcacggggctgccccgccagtggcagagcctgatcgaggagtcggctcgccggcccaagcccctcgtcgaccccgcctgca
  • Show more
Description: A cloning plasmid for the PAK4 gene.

anti- PAK4 antibody

FNab06123 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: p21 protein(Cdc42/Rac)-activated kinase 4
  • Uniprot ID: O96013
  • Gene ID: 10298
  • Research Area: Cell Division and Proliferation, Signal Transduction, Meta
  • Show more
Description: Antibody raised against PAK4

PAK4 (pS474) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mouse Pak4 Antibody

abx028063-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Pak4 Antibody

abx028063-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PAK4 Rabbit pAb

A11646-100ul 100 ul
EUR 308

PAK4 Rabbit pAb

A11646-200ul 200 ul
EUR 459

PAK4 Rabbit pAb

A11646-20ul 20 ul
EUR 183

PAK4 Rabbit pAb

A11646-50ul 50 ul
EUR 223

PAK4 Polyclonal Antibody

A55818 100 µg
EUR 570.55
Description: fast delivery possible

PAK4 Rabbit pAb

A2782-100ul 100 ul
EUR 308

PAK4 Rabbit pAb

A2782-200ul 200 ul
EUR 459

PAK4 Rabbit pAb

A2782-20ul 20 ul
EUR 183

PAK4 Rabbit pAb

A2782-50ul 50 ul
EUR 223

PAK4 Blocking Peptide

33R-10491 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK4 antibody, catalog no. 20R-1576

PAK4 Blocking Peptide

33R-10762 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK4 antibody, catalog no. 70R-11829

PAK4 Blocking Peptide

EUR 153

PAK4 Blocking Peptide

DF7078-BP 1mg
EUR 195

Anti-PAK4 antibody

PAab06123 100 ug
EUR 355


PVT12899 2 ug
EUR 391


PVT14106 2 ug
EUR 391

Anti-PAK4 antibody

STJ11100032 100 µl
EUR 413
Description: PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-PAK4 antibody

STJ24890 100 µl
EUR 277
Description: PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-PAK4 antibody

STJ113249 100 µl
EUR 277
Description: PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-PAK4 (3F10)

YF-MA17239 100 ug
EUR 363
Description: Mouse monoclonal to PAK4

shRNA-H1 (Neg)-(blasticidin) lentivirus

H1(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-H1 (Neg)-(Puromycin) lentivirus

H1(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-U6 (Neg)-(blasticidin) lentivirus

U6(shRNA-Ctr)-Bsd 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Blasticidin marker under Rsv promoter.

shRNA-U6 (Neg)-(Puromycin) lentivirus

U6(shRNA-Ctr)-Puro 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a Puromycin marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Bsd) lentivirus

H1(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( GFP-Puro) lentivirus

H1(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-H1 (Neg)-( RFP-Bsd) lentivirus

H1(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-H1(Neg)-( RFP-Puro) lentivirus

H1(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made optional inducible lentiviral shRNA expression particles under human H1 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Bsd) lentivirus

U6(shRNA-Ctr)-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( GFP-Puro) lentivirus

U6(shRNA-Ctr)-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a GFP-Puromycin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Bsd) lentivirus

U6(shRNA-Ctr)-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-Blasticidin fusion marker under Rsv promoter.

shRNA-U6 (Neg)-( RFP-Puro) lentivirus

U6(shRNA-Ctr)-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral shRNA expression particles under human U6 promoter, containing a hairpin insert that should not knockdown any known human or mouse gene. This non-targeting control serves as a negative control for shRNA knockdown experiments. It also contains a RFP-puromycin fusion marker under Rsv promoter.

Polyclonal PAK4 Antibody (Internal)

APR02254G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK4 (Internal). This antibody is tested and proven to work in the following applications:


EF001536 96 Tests
EUR 689

PAK4 (pS474) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK4 protein (His tag)

80R-1077 100 ug
EUR 397
Description: Purified recombinant Human PAK4 protein

PAK4/5/6 antibody

70R-31507 100 ug
EUR 327
Description: Rabbit polyclonal PAK4/5/6 antibody

Phospho-PAK4 (S474) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK4 (S474). Recognizes Phospho-PAK4 (S474) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PAK4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAK4. Recognizes PAK4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PAK4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAK4. Recognizes PAK4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PAK4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PAK4. Recognizes PAK4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PAK4 (phospho Ser474) Polyclonal Antibody

ES4457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PAK4 (phospho Ser474) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PAK4 (phospho Ser474) Polyclonal Antibody

ES4457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAK4 (phospho Ser474) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

PAK4/5/6 Polyclonal Antibody

ES4458-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PAK4/5/6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAK4/5/6 Polyclonal Antibody

ES4458-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAK4/5/6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAK4 (phospho Ser474) Polyclonal Antibody

ABP53458-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human PAK4 around the phosphorylation site of S474
  • Applications tips:
Description: A polyclonal antibody for detection of PAK4 phospho Ser474) from Human, Mouse, Rat. This PAK4 phospho Ser474) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PAK4 around the phosphorylation site of S474

PAK4 (phospho Ser474) Polyclonal Antibody

ABP53458-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human PAK4 around the phosphorylation site of S474
  • Applications tips:
Description: A polyclonal antibody for detection of PAK4 phospho Ser474) from Human, Mouse, Rat. This PAK4 phospho Ser474) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PAK4 around the phosphorylation site of S474

PAK4 (phospho Ser474) Polyclonal Antibody

ABP53458-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human PAK4 around the phosphorylation site of S474
  • Applications tips:
Description: A polyclonal antibody for detection of PAK4 phospho Ser474) from Human, Mouse, Rat. This PAK4 phospho Ser474) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PAK4 around the phosphorylation site of S474

PAK4/5/6 Polyclonal Antibody

ABP53459-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human PAK4 around the non-phosphorylation site of S474
  • Applications tips:
Description: A polyclonal antibody for detection of PAK4/5/6 from Human, Mouse, Rat. This PAK4/5/6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PAK4 around the non-phosphorylation site of S474

PAK4/5/6 Polyclonal Antibody

ABP53459-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human PAK4 around the non-phosphorylation site of S474
  • Applications tips:
Description: A polyclonal antibody for detection of PAK4/5/6 from Human, Mouse, Rat. This PAK4/5/6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PAK4 around the non-phosphorylation site of S474

PAK4/5/6 Polyclonal Antibody

ABP53459-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human PAK4 around the non-phosphorylation site of S474
  • Applications tips:
Description: A polyclonal antibody for detection of PAK4/5/6 from Human, Mouse, Rat. This PAK4/5/6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human PAK4 around the non-phosphorylation site of S474

PAK4 / 5 / 6 (pS474) Antibody

abx217622-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PAK4 Polyclonal Antibody, HRP Conjugated

A55819 100 µg
EUR 570.55
Description: reagents widely cited

PAK4 Polyclonal Antibody, FITC Conjugated

A55820 100 µg
EUR 570.55
Description: Ask the seller for details

PAK4 Polyclonal Antibody, Biotin Conjugated

A55821 100 µg
EUR 570.55
Description: The best epigenetics products

[KO Validated] PAK4 Rabbit pAb

A18059-100ul 100 ul
EUR 410

[KO Validated] PAK4 Rabbit pAb

A18059-200ul 200 ul
EUR 571

[KO Validated] PAK4 Rabbit pAb

A18059-20ul 20 ul
EUR 221

[KO Validated] PAK4 Rabbit pAb

A18059-50ul 50 ul
EUR 287

PAK4 ORF Vector (Human) (pORF)

ORF007494 1.0 ug DNA
EUR 95

PAK4 ORF Vector (Human) (pORF)

ORF007495 1.0 ug DNA
EUR 95

h PAK4 inducible lentiviral particles

LVP231 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PAK4, is fully sequence verified and matched to NCBI accession ID: NM_001014831

Pak4 ORF Vector (Rat) (pORF)

ORF073068 1.0 ug DNA
EUR 506

Pak4 ORF Vector (Mouse) (pORF)

ORF053325 1.0 ug DNA
EUR 506

Anti-Phospho-PAK4 (S474) antibody

STJ91133 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-PAK4 (S474).

Anti-PAK4/5/6 antibody

STJ94937 200 µl
EUR 197
Description: Rabbit polyclonal to PAK4/5/6.

Antibody for Human PAK4 (pSer474)

SPC-1044D 0.1ml
EUR 354
  • Serine/threonine protein kinase that plays a role in a variety of different signaling pathways including cytoskeleton regulation, cell migration, growth, proliferation or cell survival. Activation by various effectors including growth factor receptor
  • Show more
Description: A polyclonal antibody for PAK4 (pSer474) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser474 of human PAK4 (AA471-477). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PAK4 (pSer474) antibody is unconjugated.

Antibody for Human PAK4 (pSer474)

SPC-1044D-A390 0.1ml
EUR 401
  • Serine/threonine protein kinase that plays a role in a variety of different signaling pathways including cytoskeleton regulation, cell migration, growth, proliferation or cell survival. Activation by various effectors including growth factor receptor
  • Show more
Description: A polyclonal antibody for PAK4 (pSer474) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser474 of human PAK4 (AA471-477). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PAK4 (pSer474) antibody is conjugated to ATTO 390.

Pak4 siRNA/shRNA/RNAi