Supplemented Grace’s / TNM-FH

Supplemented Grace’s / TNM-FH 

To Order Contact us: lieven@wlsolutions.be

Grace's Supplemented Media (Hink's TNM-FH)

CM023-350 50x500ml
EUR 620

Grace's Supplemented Media (Hink's TNM-FH)

CMP23-001 10x1L
EUR 169

Grace's Supplemented Media (Hink's TNM-FH)

CMP23-010 10L
EUR 155

Grace's Supplemented Media (Hink's TNM-FH)

CMP23-050 50L
EUR 374

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-1000ML 1000 ml
EUR 96
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-500ML 500 ml
EUR 78
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-6X1000ML 6 x 1000 ml
EUR 237
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-6X500ML 6 x 500 ml
EUR 139
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

GIP06-10LT 10 L
EUR 121
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

GIP06-1LT 1 L
EUR 72
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

GIP06-50LT 50 L
EUR 347
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Insect Cell Medium: TNM-FH Insect Culture Medium

ABP-MED-10001 1 liter Ask for price
    • Product line: Cell Culture Reagents
    • Brand:

Grace's Media

CM021-050 500ml
EUR 85

Grace's Media

CM021-300 6x500ml
EUR 165

Grace's Media

CM021-310 10x500ml
EUR 219

Grace's Media

CM021-320 20x500ml
EUR 340

Grace's Media

CM021-350 50x500ml
EUR 585

Grace's Media

CMP21-001 10x1L
EUR 159

Grace's Media

CMP21-010 10L
EUR 146

Grace's Media

CMP21-050 50L
EUR 336

CMRL 1066 SUPPLEMENTED

99-603-CV 500 mL/pk
EUR 65
Description: Specialty Media; Islet products

Fh/ Rat Fh ELISA Kit

ELI-06205r 96 Tests
EUR 886

500 ML HINK'S TNM-FH MEDIUM WITH L-GLUTAMINE LACTALBUMIN HYDROLYSATE, AND YEASTOLATE, WITHOUT INSECT HEMOLYMPH

13-100-CV 500 mL/pk
EUR 117
Description: Specialty Media; Insect Media Products

Grace's With L-glutamine.

GIL01-1000ML 1000 ml
EUR 104
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.

GIL01-500ML 500 ml
EUR 82
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.

GIL01-6X1000ML 6 x 1000 ml
EUR 277
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.

GIL01-6X500ML 6 x 500 ml
EUR 161
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

FH antibody

70R-17300 50 ul
EUR 435
Description: Rabbit polyclonal FH antibody

FH Antibody

32975-100ul 100ul
EUR 252

FH antibody

10R-4121 100 ul
EUR 691
Description: Mouse monoclonal FH antibody

FH antibody

10R-4122 100 ul
EUR 726
Description: Mouse monoclonal FH antibody

FH antibody

10R-4123 100 ul
EUR 691
Description: Mouse monoclonal FH antibody

FH Antibody

1-CSB-PA000359
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000

FH Antibody

1-CSB-PA788032
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FH Antibody

DF7460 200ul
EUR 304
Description: FH Antibody detects endogenous levels of total FH.

FH Antibody

CSB-PA553013-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody

CSB-PA553013-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody

1-CSB-PA045962
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FH Antibody

1-CSB-PA008659GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FH Antibody

1-CSB-PA008659LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

FH siRNA

20-abx916886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FH siRNA

20-abx916887
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FH Antibody

ABD7460 100 ug
EUR 438

anti-FH

YF-PA23712 50 ul
EUR 334
Description: Mouse polyclonal to FH

FH Monoclonal Antibody

40442-100ul 100ul
EUR 252

FH Monoclonal Antibody

40442-50ul 50ul
EUR 187

M. pneumoniae FH

DAG2752 1 ml
EUR 1143

FH Blocking Peptide

DF7460-BP 1mg
EUR 195

Anti-FH Antibody

A02097 100ug/vial
EUR 334

Strain FH Protein

abx069951-1mg 1 mg
EUR 2555
  • Shipped within 5-10 working days.

FH Conjugated Antibody

C32975 100ul
EUR 397

FH cloning plasmid

CSB-CL008659HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1533
  • Sequence: atgtaccgagcacttcggctcctcgcgcgctcgcgtcccctcgtgcgggctccagccgcagccttagcttcggctcccggcttgggtggcgcggccgtgccctcgttttggcctccgaacgcggctcgaatggcaagccaaaattccttccggatagaatatgatacctttggtg
  • Show more
Description: A cloning plasmid for the FH gene.

FH Monoclonal Antibody

ABM40073-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody

ABM40073-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody

ABM40073-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Polyclonal Antibody

ABP50158-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody

ABP50158-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody

ABP50158-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody

A62594 100 µg
EUR 570.55
Description: kits suitable for this type of research

FH Rabbit pAb

A5688-100ul 100 ul
EUR 308

FH Rabbit pAb

A5688-200ul 200 ul
EUR 459

FH Rabbit pAb

A5688-20ul 20 ul
EUR 183

FH Rabbit pAb

A5688-50ul 50 ul
EUR 223

FH Polyclonal Antibody

ES1157-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

FH Polyclonal Antibody

ES1157-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

anti- FH antibody

FNab03106 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: fumarate hydratase
  • Uniprot ID: P07954
  • Gene ID: 2271
  • Research Area: Metabolism
Description: Antibody raised against FH

anti- FH antibody

FNab03107 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: fumarate hydratase
  • Uniprot ID: P07954
  • Gene ID: 2271
  • Research Area: Metabolism
Description: Antibody raised against FH

Anti-FH antibody

PAab03106 100 ug
EUR 355

Anti-FH antibody

PAab03107 100 ug
EUR 386

Anti-FH antibody

STJ27655 100 µl
EUR 277
Description: The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy.

Anti-FH antibody

STJ96975 200 µl
EUR 197
Description: FH is a protein encoded by the FH gene which is approximately 54,6 kDa. FH is localised to the cytoplasm and mitochondrion. It is involved in pyruvate metabolism, citric acid cycle and carbon metabolism. It is an enzymatic component of the tricarboxylic acid cycle and catalyses the formation of L-malate from fumarate. It can exist in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. FH is expressed in the cells of the nervous system, liver, skin, kidney and muscle. Mutations in the FH gene may result in fumarase deficiency. STJ96975 was developed from clone 7F1 and was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen. This antibody detects endogenous FH proteins.

Anti-FH antibody

STJ97097 200 µl
EUR 197
Description: Rabbit polyclonal to FH.

Anti-FH (3E7)

YF-MA10331 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (2E10)

YF-MA13012 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D8)

YF-MA13013 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (2C5)

YF-MA13014 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D4)

YF-MA13015 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5C12)

YF-MA13016 100 ug
EUR 363
Description: Mouse monoclonal to FH

Human Tenascin M (TNM)ELISA Kit

201-12-2600 96 tests
EUR 440
  • This Tenascin M ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Tenascin M(TNM)ELISA Kit

QY-E03061 96T
EUR 361

Polyclonal TNM / Teneurin-1 Antibody (N-Terminus)

APR13770G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNM / Teneurin-1 (N-Terminus). This antibody is tested and proven to work in the following applications:

FH (Phospho-Thr236) Antibody

11595-100ul 100ul
EUR 252

FH (Phospho-Thr236) Antibody

11595-50ul 50ul
EUR 187

Mycoplasma pneumoniae Ag (FH)

DAGA-503 1ml
EUR 897

Fumarate Hydratase (FH) Antibody

20-abx004350
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx112606
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx145820-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx159501
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx159502
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx141783
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx030263-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx030263-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx242106
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx242107
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human FH ELISA Kit

ELA-E1931h 96 Tests
EUR 824

FH/Fumarase Polyclonal Antibody

EA022-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

Supplemented Grace’s / TNM-FH