Supplemented Grace’s / TNM-FH

Supplemented Grace’s / TNM-FH 

To Order Contact us: lieven@wlsolutions.be

Grace's Supplemented Media (Hink's TNM-FH)
CM023-350	GenDepot	50x500ml	EUR 620

Grace's Supplemented Media (Hink's TNM-FH)
CMP23-001	GenDepot	10x1L	EUR 169

Grace's Supplemented Media (Hink's TNM-FH)
CMP23-010	GenDepot	10L	EUR 155

Grace's Supplemented Media (Hink's TNM-FH)
CMP23-050	GenDepot	50L	EUR 374

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-1000ML	Caisson Labs	1000 ml	EUR 96
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-500ML	Caisson Labs	500 ml	EUR 78
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-6X1000ML	Caisson Labs	6 x 1000 ml	EUR 237
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-6X500ML	Caisson Labs	6 x 500 ml	EUR 139
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.
GIP06-10LT	Caisson Labs	10 L	EUR 121
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.
GIP06-1LT	Caisson Labs	1 L	EUR 72
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.
GIP06-50LT	Caisson Labs	50 L	EUR 347
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Insect Cell Medium: TNM-FH Insect Culture Medium
ABP-MED-10001	Allele Biotech	1 liter	Ask for price
Product line: Cell Culture Reagents Brand:

Grace's Media
CM021-050	GenDepot	500ml	EUR 85

Grace's Media
CM021-300	GenDepot	6x500ml	EUR 165

Grace's Media
CM021-310	GenDepot	10x500ml	EUR 219

Grace's Media
CM021-320	GenDepot	20x500ml	EUR 340

Grace's Media
CM021-350	GenDepot	50x500ml	EUR 585

Grace's Media
CMP21-001	GenDepot	10x1L	EUR 159

Grace's Media
CMP21-010	GenDepot	10L	EUR 146

Grace's Media
CMP21-050	GenDepot	50L	EUR 336

CMRL 1066 SUPPLEMENTED
99-603-CV	CORNING	500 mL/pk	EUR 65
Description: Specialty Media; Islet products

Fh/ Rat Fh ELISA Kit
ELI-06205r	Lifescience Market	96 Tests	EUR 886

500 ML HINK'S TNM-FH MEDIUM WITH L-GLUTAMINE LACTALBUMIN HYDROLYSATE, AND YEASTOLATE, WITHOUT INSECT HEMOLYMPH
13-100-CV	CORNING	500 mL/pk	EUR 117
Description: Specialty Media; Insect Media Products

Grace's With L-glutamine.
GIL01-1000ML	Caisson Labs	1000 ml	EUR 104
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.
GIL01-500ML	Caisson Labs	500 ml	EUR 82
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.
GIL01-6X1000ML	Caisson Labs	6 x 1000 ml	EUR 277
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.
GIL01-6X500ML	Caisson Labs	6 x 500 ml	EUR 161
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

FH siRNA
20-abx916886	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FH siRNA
20-abx916887	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FH Antibody
ABD7460	Lifescience Market	100 ug	EUR 438

FH Antibody
32975-100ul	SAB	100ul	EUR 252

FH antibody
10R-4121	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FH antibody

FH antibody
10R-4122	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal FH antibody

FH antibody
10R-4123	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FH antibody

FH antibody
70R-17300	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FH antibody

FH Antibody
DF7460	Affbiotech	200ul	EUR 304
Description: FH Antibody detects endogenous levels of total FH.

FH Antibody
1-CSB-PA000359	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000

FH Antibody
1-CSB-PA788032	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FH Antibody
CSB-PA553013-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody
CSB-PA553013-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody
1-CSB-PA008659GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FH Antibody
1-CSB-PA008659LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

FH Antibody
1-CSB-PA045962	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

anti-FH
YF-PA23712	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to FH

FH Conjugated Antibody
C32975	SAB	100ul	EUR 397

FH cloning plasmid
CSB-CL008659HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1533 Sequence: atgtaccgagcacttcggctcctcgcgcgctcgcgtcccctcgtgcgggctccagccgcagccttagcttcggctcccggcttgggtggcgcggccgtgccctcgttttggcctccgaacgcggctcgaatggcaagccaaaattccttccggatagaatatgatacctttggtg Show more
Description: A cloning plasmid for the FH gene.

anti- FH antibody
FNab03106	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: fumarate hydratase Uniprot ID: P07954 Gene ID: 2271 Research Area: Metabolism
Description: Antibody raised against FH

anti- FH antibody
FNab03107	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IF: 1:10-1:100 Immunogen: fumarate hydratase Uniprot ID: P07954 Gene ID: 2271 Research Area: Metabolism
Description: Antibody raised against FH

FH Polyclonal Antibody
ES1157-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

FH Polyclonal Antibody
ES1157-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

Strain FH Protein
abx069951-1mg	Abbexa	1 mg	EUR 2555
Shipped within 5-10 working days.

FH Polyclonal Antibody
ABP50158-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody
ABP50158-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody
ABP50158-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Monoclonal Antibody
ABM40073-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody
ABM40073-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody
ABM40073-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Anti-FH Antibody
A02097	BosterBio	100ug/vial	EUR 334

FH Polyclonal Antibody
A62594	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

FH Rabbit pAb
A5688-100ul	Abclonal	100 ul	EUR 308

FH Rabbit pAb
A5688-200ul	Abclonal	200 ul	EUR 459

FH Rabbit pAb
A5688-20ul	Abclonal	20 ul	EUR 183

FH Rabbit pAb
A5688-50ul	Abclonal	50 ul	EUR 223

FH Monoclonal Antibody
40442-100ul	SAB	100ul	EUR 252

FH Monoclonal Antibody
40442-50ul	SAB	50ul	EUR 187

FH Blocking Peptide
DF7460-BP	Affbiotech	1mg	EUR 195

M. pneumoniae FH
DAG2752	Creative Diagnostics	1 ml	EUR 1143

Anti-FH antibody
PAab03106	Lifescience Market	100 ug	EUR 355

Anti-FH antibody
PAab03107	Lifescience Market	100 ug	EUR 386

Anti-FH antibody
STJ96975	St John's Laboratory	200 µl	EUR 197
Description: FH is a protein encoded by the FH gene which is approximately 54,6 kDa. FH is localised to the cytoplasm and mitochondrion. It is involved in pyruvate metabolism, citric acid cycle and carbon metabolism. It is an enzymatic component of the tricarboxylic acid cycle and catalyses the formation of L-malate from fumarate. It can exist in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. FH is expressed in the cells of the nervous system, liver, skin, kidney and muscle. Mutations in the FH gene may result in fumarase deficiency. STJ96975 was developed from clone 7F1 and was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen. This antibody detects endogenous FH proteins.

Anti-FH antibody
STJ97097	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to FH.

Anti-FH antibody
STJ27655	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy.

Anti-FH (2E10)
YF-MA13012	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D8)
YF-MA13013	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (2C5)
YF-MA13014	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D4)
YF-MA13015	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5C12)
YF-MA13016	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (3E7)
YF-MA10331	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Human Tenascin M (TNM)ELISA Kit
201-12-2600	SunredBio	96 tests	EUR 440
This Tenascin M ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Tenascin M(TNM)ELISA Kit
QY-E03061	Qayee Biotechnology	96T	EUR 361

Polyclonal TNM / Teneurin-1 Antibody (N-Terminus)
APR13770G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNM / Teneurin-1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Phospho-FH(Thr90) Antibody
AF8603	Affbiotech	200ul	EUR 376
Description: Phospho-FH(T90) Antibody detects endogenous levels of FH only when phosphorylated at T90.

Recombinant Human Fumarase/FH
C224-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Recombinant Human Fumarase/FH
C224-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Recombinant Human Fumarase/FH
C224-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Recombinant Human Fumarase/FH
C224-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Human FH ELISA Kit
ELA-E1931h	Lifescience Market	96 Tests	EUR 824

FH/Fumarase Polyclonal Antibody
EA022-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Polyclonal Antibody
EA022-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH ELISA KIT|Human
EF006104	Lifescience Market	96 Tests	EUR 689

FH/Fumarase Monoclonal Antibody
EM1073-100ul	ELK Biotech	100ul	EUR 279
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Monoclonal Antibody
EM1073-50ul	ELK Biotech	50ul	EUR 207
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Monoclonal Antibody
EM1156-100ul	ELK Biotech	100ul	EUR 279
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Monoclonal Antibody
EM1156-50ul	ELK Biotech	50ul	EUR 207
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

Fumarate Hydratase (FH) Antibody
20-abx112606	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx141783	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx159501	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx159502	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx145820-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx004350	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx030263-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx030263-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

FH Fumarase Monoclonal Antibody
ABM40156-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein Applications tips:
Description: A monoclonal antibody for detection of FH Fumarase from Human, Mouse, Rat. This FH Fumarase antibody is for WB, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

FH Fumarase Monoclonal Antibody
ABM40156-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein Applications tips:
Description: A monoclonal antibody for detection of FH Fumarase from Human, Mouse, Rat. This FH Fumarase antibody is for WB, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

FH Fumarase Monoclonal Antibody
ABM40156-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein Applications tips:
Description: A monoclonal antibody for detection of FH Fumarase from Human, Mouse, Rat. This FH Fumarase antibody is for WB, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

Fumarate Hydratase (FH) Antibody
20-abx326980	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx332794-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx318513	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx242106	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx242107	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx233106-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Fumarate Hydratase (FH) Antibody
abx233107-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

FH (Phospho-Thr236) Antibody
11595-100ul	SAB	100ul	EUR 252

FH (Phospho-Thr236) Antibody
11595-50ul	SAB	50ul	EUR 187

Mouse FH shRNA Plasmid
20-abx970336	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FH shRNA Plasmid
20-abx951588	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mycoplasma pneumoniae Ag (FH)
DAGA-503	Creative Diagnostics	1ml	EUR 897

FH Antibody, HRP conjugated
1-CSB-PA008659LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FH Antibody, FITC conjugated
1-CSB-PA008659LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FH Antibody, Biotin conjugated
1-CSB-PA008659LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti-FH/Fumarase (5B8)
LF-MA20366	Abfrontier	100 ug	EUR 354
Description: Mouse monoclonal to FH/Fumarase

FH Recombinant Protein (Human)
RP012160	ABM	100 ug	Ask for price

FH Recombinant Protein (Rat)
RP201383	ABM	100 ug	Ask for price

Anti-Fumarase / FH antibody
STJ71221	St John's Laboratory	100 µg	EUR 359

Anti-FH Fumarase antibody
STJ97058	St John's Laboratory	200 µl	EUR 197
Description: Mouse monoclonal to FH Fumarase.

Grace's With L-glutamine. No sodium bicarbonate.
GIP05-10LT	Caisson Labs	10 L	EUR 101
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine. No sodium bicarbonate.

Grace's With L-glutamine. No sodium bicarbonate.
GIP05-10X1LT	Caisson Labs	10 x 1 L	EUR 105
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine. No sodium bicarbonate.

Grace's With L-glutamine. No sodium bicarbonate.
GIP05-50LT	Caisson Labs	50 L	EUR 230
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine. No sodium bicarbonate.

Phospho-FH(Thr90) Blocking Peptide
AF8603-BP	Affbiotech	1mg	EUR 195

Polyclonal FH Antibody (N-term)
APR07732G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal FH Antibody (N-term)
AMM04545G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH (N-term). This antibody is tested and proven to work in the following applications:

Mycoplasma pneumoniae (Strain FH) Protein
abx069889-05mg	Abbexa	0.5 mg	EUR 1803
Shipped within 5-10 working days.

Mycoplasma pneumoniae (Strain FH) Protein
abx069890-1ml	Abbexa	1 ml	EUR 739
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody (HRP)
20-abx303862	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody (FITC)
20-abx303863	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody (Biotin)
20-abx303864	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

FH Polyclonal Antibody, HRP Conjugated
A62595	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

FH Polyclonal Antibody, FITC Conjugated
A62596	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

FH Polyclonal Antibody, Biotin Conjugated
A62597	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Mycoplasma pneumoniae Ag (FH, >95%)
DAGA-504	Creative Diagnostics	1mg	EUR 502

FH ORF Vector (Human) (pORF)
ORF004054	ABM	1.0 ug DNA	EUR 95

Fh ORF Vector (Rat) (pORF)
ORF067129	ABM	1.0 ug DNA	EUR 506

Anti-FH Antibody (monoclonal, 9D8)
M02097	BosterBio	100ug/vial	EUR 334

Anti-Fumarase / FH, Biotinylated antibody
STJ73177	St John's Laboratory	100 µg	EUR 359

FH ELISA Kit (Mouse) (OKEH05295)
OKEH05295	Aviva Systems Biology	96 Wells	EUR 766
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

FH ELISA Kit (Rat) (OKEH06083)
OKEH06083	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Grace's With L-glutamine. W/O L-methionine.
GIL03-500ML	Caisson Labs	500 ml	EUR 94
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine. Without L-methionine.

Grace's With L-glutamine. W/O L-methionine.
GIL03-6X500ML	Caisson Labs	6 x 500 ml	EUR 226
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine. Without L-methionine.

Polyclonal FH / Fumarase / MCL Antibody (Internal)
AMM04542G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FH / Fumarase / MCL (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-Fumarase / FH Antibody
AMM04983G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Fumarase / FH . This antibody is tested and proven to work in the following applications:

Mouse Fumarate Hydratase (FH) ELISA Kit
abx518865-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Pig Fumarate Hydratase (FH) ELISA Kit
abx518866-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Fumarate Hydratase (FH) ELISA Kit
abx518867-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

FH (Phospho-Thr236) Polyclonal Conjugated Antibody
C11595	SAB	100ul	EUR 397

FH sgRNA CRISPR Lentivector set (Human)
K0781401	ABM	3 x 1.0 ug	EUR 339

Mycoplasma pneumoniae Antigen (Strain FH) Protein
abx160036-1ml	Abbexa	1 ml	EUR 787
Shipped within 5-10 working days.

Human Fumarate Hydratase (FH) ELISA Kit
abx251329-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Polyclonal FH / Fumarase / MCL Antibody (aa195-473)
AMM04539G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH / Fumarase / MCL (aa195-473). This antibody is tested and proven to work in the following applications:

Polyclonal FH / Fumarase / MCL Antibody (aa89-365)
AMM04540G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH / Fumarase / MCL (aa89-365). This antibody is tested and proven to work in the following applications:

Monoclonal FH Antibody (monoclonal) (M07), Clone: 5C12
AMM04543G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human FH (monoclonal) (M07). The antibodies are raised in mouse and are from clone 5C12. This antibody is applicable in WB and IF, E

Monoclonal FH Antibody (monoclonal) (M09), Clone: 3E8
AMM04544G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human FH (monoclonal) (M09). The antibodies are raised in mouse and are from clone 3E8. This antibody is applicable in WB and IHC, E

Goat Fumae hydase, mitochondrial(FH) ELISA kit
E06F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Fumae hydase, mitochondrial(FH) ELISA kit
E06F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Fumae hydase, mitochondrial(FH) ELISA kit
E06F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fumae hydase, mitochondrial(FH) ELISA kit
E02F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fumae hydase, mitochondrial(FH) ELISA kit
E02F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fumae hydase, mitochondrial(FH) ELISA kit
E02F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fumae hydase, mitochondrial(FH) ELISA kit
E03F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fumae hydase, mitochondrial(FH) ELISA kit
E03F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fumae hydase, mitochondrial(FH) ELISA kit
E03F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Fumae hydase, mitochondrial(FH) ELISA kit
E04F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Fumae hydase, mitochondrial(FH) ELISA kit
E04F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Fumae hydase, mitochondrial(FH) ELISA kit
E04F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fumae hydase, mitochondrial(FH) ELISA kit
E01F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fumae hydase, mitochondrial(FH) ELISA kit
E01F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fumae hydase, mitochondrial(FH) ELISA kit
E01F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Fumae hydase, mitochondrial(FH) ELISA kit
E08F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Fumae hydase, mitochondrial(FH) ELISA kit
E08F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Fumae hydase, mitochondrial(FH) ELISA kit
E08F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Fumae hydase, mitochondrial(FH) ELISA kit
E07F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Fumae hydase, mitochondrial(FH) ELISA kit
E07F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Fumae hydase, mitochondrial(FH) ELISA kit
E07F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Fumae hydase, mitochondrial(FH) ELISA kit
E09F0368-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Fumae hydase, mitochondrial(FH) ELISA kit
E09F0368-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Fumae hydase, mitochondrial(FH) ELISA kit
E09F0368-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FH/ Fumarate hydratase, mitochondrial ELISA Kit
E0914Hu	Sunlong	1 Kit	EUR 571

Human FH(Fumarate hydratase, mitochondrial) ELISA Kit
EH2005	FN Test	96T	EUR 567.6
Detection range: 78-5000 ng/ml Uniprot ID: P07954 Alias: FH/Fumarate hydratase, mitochondrial/Fumarase/HLRCC/LRCC/MCL/MCUL1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9 ng/ml

Mouse Fumarate hydratase, mitochondrial, Fh ELISA KIT
ELI-06204m	Lifescience Market	96 Tests	EUR 865

Porcine Fumarate hydratase, mitochondrial, FH ELISA KIT
ELI-06206p	Lifescience Market	96 Tests	EUR 928

Human Fumarate hydratase, mitochondrial, FH ELISA KIT
ELI-06207h	Lifescience Market	96 Tests	EUR 824

FH sgRNA CRISPR Lentivector (Human) (Target 1)
K0781402	ABM	1.0 ug DNA	EUR 154

FH sgRNA CRISPR Lentivector (Human) (Target 2)
K0781403	ABM	1.0 ug DNA	EUR 154

FH sgRNA CRISPR Lentivector (Human) (Target 3)
K0781404	ABM	1.0 ug DNA	EUR 154

FH Protein Vector (Rat) (pPB-C-His)
PV268514	ABM	500 ng	EUR 603

FH Protein Vector (Rat) (pPB-N-His)
PV268515	ABM	500 ng	EUR 603

FH Protein Vector (Rat) (pPM-C-HA)
PV268516	ABM	500 ng	EUR 603

FH Protein Vector (Rat) (pPM-C-His)
PV268517	ABM	500 ng	EUR 603

Supplemented Grace’s / TNM-FH