Supplemented Grace’s / TNM-FH

Supplemented Grace’s / TNM-FH 

To Order Contact us: lieven@wlsolutions.be

Grace's Supplemented Media (Hink's TNM-FH)

CM023-350 50x500ml
EUR 620

Grace's Supplemented Media (Hink's TNM-FH)

CMP23-001 10x1L
EUR 169

Grace's Supplemented Media (Hink's TNM-FH)

CMP23-010 10L
EUR 155

Grace's Supplemented Media (Hink's TNM-FH)

CMP23-050 50L
EUR 374

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-1000ML 1000 ml
EUR 96
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-500ML 500 ml
EUR 78
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-6X1000ML 6 x 1000 ml
EUR 237
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

GIL02-6X500ML 6 x 500 ml
EUR 139
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

GIP06-10LT 10 L
EUR 121
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

GIP06-1LT 1 L
EUR 72
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

GIP06-50LT 50 L
EUR 347
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Insect Cell Medium: TNM-FH Insect Culture Medium

ABP-MED-10001 1 liter Ask for price
    • Product line: Cell Culture Reagents
    • Brand:

Grace's Media

CM021-050 500ml
EUR 85

Grace's Media

CM021-300 6x500ml
EUR 165

Grace's Media

CM021-310 10x500ml
EUR 219

Grace's Media

CM021-320 20x500ml
EUR 340

Grace's Media

CM021-350 50x500ml
EUR 585

Grace's Media

CMP21-001 10x1L
EUR 159

Grace's Media

CMP21-010 10L
EUR 146

Grace's Media

CMP21-050 50L
EUR 336

CMRL 1066 SUPPLEMENTED

99-603-CV 500 mL/pk
EUR 65
Description: Specialty Media; Islet products

Fh/ Rat Fh ELISA Kit

ELI-06205r 96 Tests
EUR 886

500 ML HINK'S TNM-FH MEDIUM WITH L-GLUTAMINE LACTALBUMIN HYDROLYSATE, AND YEASTOLATE, WITHOUT INSECT HEMOLYMPH

13-100-CV 500 mL/pk
EUR 117
Description: Specialty Media; Insect Media Products

Grace's With L-glutamine.

GIL01-1000ML 1000 ml
EUR 104
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.

GIL01-500ML 500 ml
EUR 82
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.

GIL01-6X1000ML 6 x 1000 ml
EUR 277
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.

GIL01-6X500ML 6 x 500 ml
EUR 161
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine.

FH siRNA

20-abx916886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FH siRNA

20-abx916887
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FH Antibody

ABD7460 100 ug
EUR 438

FH Antibody

32975-100ul 100ul
EUR 252

FH antibody

10R-4121 100 ul
EUR 691
Description: Mouse monoclonal FH antibody

FH antibody

10R-4122 100 ul
EUR 726
Description: Mouse monoclonal FH antibody

FH antibody

10R-4123 100 ul
EUR 691
Description: Mouse monoclonal FH antibody

FH antibody

70R-17300 50 ul
EUR 435
Description: Rabbit polyclonal FH antibody

FH Antibody

DF7460 200ul
EUR 304
Description: FH Antibody detects endogenous levels of total FH.

FH Antibody

1-CSB-PA000359
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000

FH Antibody

1-CSB-PA788032
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FH Antibody

CSB-PA553013-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody

CSB-PA553013-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody

1-CSB-PA008659GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FH Antibody

1-CSB-PA008659LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

FH Antibody

1-CSB-PA045962
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

anti-FH

YF-PA23712 50 ul
EUR 334
Description: Mouse polyclonal to FH

FH Conjugated Antibody

C32975 100ul
EUR 397

FH cloning plasmid

CSB-CL008659HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1533
  • Sequence: atgtaccgagcacttcggctcctcgcgcgctcgcgtcccctcgtgcgggctccagccgcagccttagcttcggctcccggcttgggtggcgcggccgtgccctcgttttggcctccgaacgcggctcgaatggcaagccaaaattccttccggatagaatatgatacctttggtg
  • Show more
Description: A cloning plasmid for the FH gene.

anti- FH antibody

FNab03106 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: fumarate hydratase
  • Uniprot ID: P07954
  • Gene ID: 2271
  • Research Area: Metabolism
Description: Antibody raised against FH

anti- FH antibody

FNab03107 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: fumarate hydratase
  • Uniprot ID: P07954
  • Gene ID: 2271
  • Research Area: Metabolism
Description: Antibody raised against FH

FH Polyclonal Antibody

ES1157-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

FH Polyclonal Antibody

ES1157-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

Strain FH Protein

abx069951-1mg 1 mg
EUR 2555
  • Shipped within 5-10 working days.

FH Polyclonal Antibody

ABP50158-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody

ABP50158-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody

ABP50158-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Monoclonal Antibody

ABM40073-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody

ABM40073-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody

ABM40073-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

Anti-FH Antibody

A02097 100ug/vial
EUR 334

FH Polyclonal Antibody

A62594 100 µg
EUR 570.55
Description: kits suitable for this type of research

FH Rabbit pAb

A5688-100ul 100 ul
EUR 308

FH Rabbit pAb

A5688-200ul 200 ul
EUR 459

FH Rabbit pAb

A5688-20ul 20 ul
EUR 183

FH Rabbit pAb

A5688-50ul 50 ul
EUR 223

FH Monoclonal Antibody

40442-100ul 100ul
EUR 252

FH Monoclonal Antibody

40442-50ul 50ul
EUR 187

FH Blocking Peptide

DF7460-BP 1mg
EUR 195

M. pneumoniae FH

DAG2752 1 ml
EUR 1143

Anti-FH antibody

PAab03106 100 ug
EUR 355

Anti-FH antibody

PAab03107 100 ug
EUR 386

Anti-FH antibody

STJ96975 200 µl
EUR 197
Description: FH is a protein encoded by the FH gene which is approximately 54,6 kDa. FH is localised to the cytoplasm and mitochondrion. It is involved in pyruvate metabolism, citric acid cycle and carbon metabolism. It is an enzymatic component of the tricarboxylic acid cycle and catalyses the formation of L-malate from fumarate. It can exist in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. FH is expressed in the cells of the nervous system, liver, skin, kidney and muscle. Mutations in the FH gene may result in fumarase deficiency. STJ96975 was developed from clone 7F1 and was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen. This antibody detects endogenous FH proteins.

Anti-FH antibody

STJ97097 200 µl
EUR 197
Description: Rabbit polyclonal to FH.

Anti-FH antibody

STJ27655 100 µl
EUR 277
Description: The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy.

Anti-FH (2E10)

YF-MA13012 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D8)

YF-MA13013 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (2C5)

YF-MA13014 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D4)

YF-MA13015 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5C12)

YF-MA13016 100 ug
EUR 363
Description: Mouse monoclonal to FH

Anti-FH (3E7)

YF-MA10331 100 ug
EUR 363
Description: Mouse monoclonal to FH

Human Tenascin M (TNM)ELISA Kit

201-12-2600 96 tests
EUR 440
  • This Tenascin M ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Tenascin M(TNM)ELISA Kit

QY-E03061 96T
EUR 361

Polyclonal TNM / Teneurin-1 Antibody (N-Terminus)

APR13770G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNM / Teneurin-1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Phospho-FH(Thr90) Antibody

AF8603 200ul
EUR 376
Description: Phospho-FH(T90) Antibody detects endogenous levels of FH only when phosphorylated at T90.

Recombinant Human Fumarase/FH

C224-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Recombinant Human Fumarase/FH

C224-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Recombinant Human Fumarase/FH

C224-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Recombinant Human Fumarase/FH

C224-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM Tris, pH 8.0.

Human FH ELISA Kit

ELA-E1931h 96 Tests
EUR 824

FH/Fumarase Polyclonal Antibody

EA022-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Polyclonal Antibody

EA022-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH ELISA KIT|Human

EF006104 96 Tests
EUR 689

FH/Fumarase Monoclonal Antibody

EM1073-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Monoclonal Antibody

EM1073-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Monoclonal Antibody

EM1156-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

FH/Fumarase Monoclonal Antibody

EM1156-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

Fumarate Hydratase (FH) Antibody

20-abx112606
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx141783
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx159501
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx159502
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx145820-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx004350
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx030263-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx030263-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FH Fumarase Monoclonal Antibody

ABM40156-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of FH Fumarase from Human, Mouse, Rat. This FH Fumarase antibody is for WB, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

FH Fumarase Monoclonal Antibody

ABM40156-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of FH Fumarase from Human, Mouse, Rat. This FH Fumarase antibody is for WB, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

FH Fumarase Monoclonal Antibody

ABM40156-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A monoclonal antibody for detection of FH Fumarase from Human, Mouse, Rat. This FH Fumarase antibody is for WB, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

Fumarate Hydratase (FH) Antibody

20-abx326980
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx332794-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx318513
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx242106
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

20-abx242107
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody

abx233106-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fumarate Hydratase (FH) Antibody

abx233107-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

FH (Phospho-Thr236) Antibody

11595-100ul 100ul
EUR 252

FH (Phospho-Thr236) Antibody

11595-50ul 50ul
EUR 187

Mouse FH shRNA Plasmid

20-abx970336
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FH shRNA Plasmid

20-abx951588
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mycoplasma pneumoniae Ag (FH)

DAGA-503 1ml
EUR 897

FH Antibody, HRP conjugated

1-CSB-PA008659LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FH Antibody, FITC conjugated

1-CSB-PA008659LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FH Antibody, Biotin conjugated

1-CSB-PA008659LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti-FH/Fumarase (5B8)

LF-MA20366 100 ug
EUR 354
Description: Mouse monoclonal to FH/Fumarase

FH Recombinant Protein (Human)

RP012160 100 ug Ask for price

FH Recombinant Protein (Rat)

RP201383 100 ug Ask for price

Anti-Fumarase / FH antibody

STJ71221 100 µg
EUR 359

Anti-FH Fumarase antibody

STJ97058 200 µl
EUR 197
Description: Mouse monoclonal to FH Fumarase.

Grace's With L-glutamine. No sodium bicarbonate.

GIP05-10LT 10 L
EUR 101
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine. No sodium bicarbonate.

Grace's With L-glutamine. No sodium bicarbonate.

GIP05-10X1LT 10 x 1 L
EUR 105
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine. No sodium bicarbonate.

Grace's With L-glutamine. No sodium bicarbonate.

GIP05-50LT 50 L
EUR 230
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine. No sodium bicarbonate.

Phospho-FH(Thr90) Blocking Peptide

AF8603-BP 1mg
EUR 195

Polyclonal FH Antibody (N-term)

APR07732G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal FH Antibody (N-term)

AMM04545G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH (N-term). This antibody is tested and proven to work in the following applications:

Mycoplasma pneumoniae (Strain FH) Protein

abx069889-05mg 0.5 mg
EUR 1803
  • Shipped within 5-10 working days.

Mycoplasma pneumoniae (Strain FH) Protein

abx069890-1ml 1 ml
EUR 739
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody (HRP)

20-abx303862
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody (FITC)

20-abx303863
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody (Biotin)

20-abx303864
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FH Polyclonal Antibody, HRP Conjugated

A62595 100 µg
EUR 570.55
Description: fast delivery possible

FH Polyclonal Antibody, FITC Conjugated

A62596 100 µg
EUR 570.55
Description: reagents widely cited

FH Polyclonal Antibody, Biotin Conjugated

A62597 100 µg
EUR 570.55
Description: Ask the seller for details

Mycoplasma pneumoniae Ag (FH, >95%)

DAGA-504 1mg
EUR 502

FH ORF Vector (Human) (pORF)

ORF004054 1.0 ug DNA
EUR 95

Fh ORF Vector (Rat) (pORF)

ORF067129 1.0 ug DNA
EUR 506

Anti-FH Antibody (monoclonal, 9D8)

M02097 100ug/vial
EUR 334

Anti-Fumarase / FH, Biotinylated antibody

STJ73177 100 µg
EUR 359

FH ELISA Kit (Mouse) (OKEH05295)

OKEH05295 96 Wells
EUR 766
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

FH ELISA Kit (Rat) (OKEH06083)

OKEH06083 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Grace's With L-glutamine. W/O L-methionine.

GIL03-500ML 500 ml
EUR 94
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine. Without L-methionine.

Grace's With L-glutamine. W/O L-methionine.

GIL03-6X500ML 6 x 500 ml
EUR 226
  • Product line: Animal Cell Culture Media
  • Product family: Grace's Insect Media
Description: With L-glutamine. Without L-methionine.

Polyclonal FH / Fumarase / MCL Antibody (Internal)

AMM04542G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FH / Fumarase / MCL (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-Fumarase / FH Antibody

AMM04983G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Fumarase / FH . This antibody is tested and proven to work in the following applications:

Mouse Fumarate Hydratase (FH) ELISA Kit

abx518865-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Fumarate Hydratase (FH) ELISA Kit

abx518866-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Fumarate Hydratase (FH) ELISA Kit

abx518867-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

FH (Phospho-Thr236) Polyclonal Conjugated Antibody

C11595 100ul
EUR 397

FH sgRNA CRISPR Lentivector set (Human)

K0781401 3 x 1.0 ug
EUR 339

Mycoplasma pneumoniae Antigen (Strain FH) Protein

abx160036-1ml 1 ml
EUR 787
  • Shipped within 5-10 working days.

Human Fumarate Hydratase (FH) ELISA Kit

abx251329-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Polyclonal FH / Fumarase / MCL Antibody (aa195-473)

AMM04539G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH / Fumarase / MCL (aa195-473). This antibody is tested and proven to work in the following applications:

Polyclonal FH / Fumarase / MCL Antibody (aa89-365)

AMM04540G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FH / Fumarase / MCL (aa89-365). This antibody is tested and proven to work in the following applications:

Monoclonal FH Antibody (monoclonal) (M07), Clone: 5C12

AMM04543G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FH (monoclonal) (M07). The antibodies are raised in mouse and are from clone 5C12. This antibody is applicable in WB and IF, E

Monoclonal FH Antibody (monoclonal) (M09), Clone: 3E8

AMM04544G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FH (monoclonal) (M09). The antibodies are raised in mouse and are from clone 3E8. This antibody is applicable in WB and IHC, E

Goat Fumae hydase, mitochondrial(FH) ELISA kit

E06F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Fumae hydase, mitochondrial(FH) ELISA kit

E06F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Fumae hydase, mitochondrial(FH) ELISA kit

E06F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fumae hydase, mitochondrial(FH) ELISA kit

E02F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fumae hydase, mitochondrial(FH) ELISA kit

E02F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Fumae hydase, mitochondrial(FH) ELISA kit

E02F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fumae hydase, mitochondrial(FH) ELISA kit

E03F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fumae hydase, mitochondrial(FH) ELISA kit

E03F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Fumae hydase, mitochondrial(FH) ELISA kit

E03F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Fumae hydase, mitochondrial(FH) ELISA kit

E04F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Fumae hydase, mitochondrial(FH) ELISA kit

E04F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Fumae hydase, mitochondrial(FH) ELISA kit

E04F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fumae hydase, mitochondrial(FH) ELISA kit

E01F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fumae hydase, mitochondrial(FH) ELISA kit

E01F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fumae hydase, mitochondrial(FH) ELISA kit

E01F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Fumae hydase, mitochondrial(FH) ELISA kit

E08F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Fumae hydase, mitochondrial(FH) ELISA kit

E08F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Fumae hydase, mitochondrial(FH) ELISA kit

E08F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Fumae hydase, mitochondrial(FH) ELISA kit

E07F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Fumae hydase, mitochondrial(FH) ELISA kit

E07F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Fumae hydase, mitochondrial(FH) ELISA kit

E07F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Fumae hydase, mitochondrial(FH) ELISA kit

E09F0368-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Fumae hydase, mitochondrial(FH) ELISA kit

E09F0368-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Fumae hydase, mitochondrial(FH) ELISA kit

E09F0368-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Fumae hydase, mitochondrial(FH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FH/ Fumarate hydratase, mitochondrial ELISA Kit

E0914Hu 1 Kit
EUR 571

Human FH(Fumarate hydratase, mitochondrial) ELISA Kit

EH2005 96T
EUR 567.6
  • Detection range: 78-5000 ng/ml
  • Uniprot ID: P07954
  • Alias: FH/Fumarate hydratase, mitochondrial/Fumarase/HLRCC/LRCC/MCL/MCUL1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9 ng/ml

Mouse Fumarate hydratase, mitochondrial, Fh ELISA KIT

ELI-06204m 96 Tests
EUR 865

Porcine Fumarate hydratase, mitochondrial, FH ELISA KIT

ELI-06206p 96 Tests
EUR 928

Human Fumarate hydratase, mitochondrial, FH ELISA KIT

ELI-06207h 96 Tests
EUR 824

FH sgRNA CRISPR Lentivector (Human) (Target 1)

K0781402 1.0 ug DNA
EUR 154

FH sgRNA CRISPR Lentivector (Human) (Target 2)

K0781403 1.0 ug DNA
EUR 154

FH sgRNA CRISPR Lentivector (Human) (Target 3)

K0781404 1.0 ug DNA
EUR 154

FH Protein Vector (Rat) (pPB-C-His)

PV268514 500 ng
EUR 603

FH Protein Vector (Rat) (pPB-N-His)

PV268515 500 ng
EUR 603

FH Protein Vector (Rat) (pPM-C-HA)

PV268516 500 ng
EUR 603

FH Protein Vector (Rat) (pPM-C-His)

PV268517 500 ng
EUR 603

Supplemented Grace’s / TNM-FH