Supplemented Grace’s / TNM-FH

Supplemented Grace’s / TNM-FH 

To Order Contact us: lieven@wlsolutions.be

Grace's Supplemented Media (Hink's TNM-FH)
CM023-350	GenDepot	50x500ml	EUR 620

Grace's Supplemented Media (Hink's TNM-FH)
CMP23-001	GenDepot	10x1L	EUR 169

Grace's Supplemented Media (Hink's TNM-FH)
CMP23-010	GenDepot	10L	EUR 155

Grace's Supplemented Media (Hink's TNM-FH)
CMP23-050	GenDepot	50L	EUR 374

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-1000ML	Caisson Labs	1000 ml	EUR 96
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-500ML	Caisson Labs	500 ml	EUR 78
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-6X1000ML	Caisson Labs	6 x 1000 ml	EUR 237
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.
GIL02-6X500ML	Caisson Labs	6 x 500 ml	EUR 139
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.
GIP06-10LT	Caisson Labs	10 L	EUR 121
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.
GIP06-1LT	Caisson Labs	1 L	EUR 72
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Supplemented Grace's / TNM-FH (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.
GIP06-50LT	Caisson Labs	50 L	EUR 347
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: (Hink's TNM-FH) with 3,330 mg/L yeastolate and 3,330 mg/L lactalbumin hydrolysate. No sodium bicarbonate.

Insect Cell Medium: TNM-FH Insect Culture Medium
ABP-MED-10001	Allele Biotech	1 liter	Ask for price
Product line: Cell Culture Reagents Brand:

Grace's Media
CM021-050	GenDepot	500ml	EUR 85

Grace's Media
CM021-300	GenDepot	6x500ml	EUR 165

Grace's Media
CM021-310	GenDepot	10x500ml	EUR 219

Grace's Media
CM021-320	GenDepot	20x500ml	EUR 340

Grace's Media
CM021-350	GenDepot	50x500ml	EUR 585

Grace's Media
CMP21-001	GenDepot	10x1L	EUR 159

Grace's Media
CMP21-010	GenDepot	10L	EUR 146

Grace's Media
CMP21-050	GenDepot	50L	EUR 336

CMRL 1066 SUPPLEMENTED
99-603-CV	CORNING	500 mL/pk	EUR 65
Description: Specialty Media; Islet products

Fh/ Rat Fh ELISA Kit
ELI-06205r	Lifescience Market	96 Tests	EUR 886

500 ML HINK'S TNM-FH MEDIUM WITH L-GLUTAMINE LACTALBUMIN HYDROLYSATE, AND YEASTOLATE, WITHOUT INSECT HEMOLYMPH
13-100-CV	CORNING	500 mL/pk	EUR 117
Description: Specialty Media; Insect Media Products

Grace's With L-glutamine.
GIL01-1000ML	Caisson Labs	1000 ml	EUR 104
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.
GIL01-500ML	Caisson Labs	500 ml	EUR 82
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.
GIL01-6X1000ML	Caisson Labs	6 x 1000 ml	EUR 277
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

Grace's With L-glutamine.
GIL01-6X500ML	Caisson Labs	6 x 500 ml	EUR 161
Product line: Animal Cell Culture Media Product family: Grace's Insect Media
Description: With L-glutamine.

FH antibody
70R-17300	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FH antibody

FH Antibody
32975-100ul	SAB	100ul	EUR 252

FH antibody
10R-4121	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FH antibody

FH antibody
10R-4122	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal FH antibody

FH antibody
10R-4123	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal FH antibody

FH Antibody
1-CSB-PA000359	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB;WB:1:1000

FH Antibody
1-CSB-PA788032	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FH Antibody
DF7460	Affbiotech	200ul	EUR 304
Description: FH Antibody detects endogenous levels of total FH.

FH Antibody
CSB-PA553013-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody
CSB-PA553013-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FH Antibody
1-CSB-PA045962	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FH Antibody
1-CSB-PA008659GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FH Antibody
1-CSB-PA008659LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FH. Recognizes FH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

FH siRNA
20-abx916886	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FH siRNA
20-abx916887	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FH Antibody
ABD7460	Lifescience Market	100 ug	EUR 438

anti-FH
YF-PA23712	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to FH

FH Monoclonal Antibody
40442-100ul	SAB	100ul	EUR 252

FH Monoclonal Antibody
40442-50ul	SAB	50ul	EUR 187

M. pneumoniae FH
DAG2752	Creative Diagnostics	1 ml	EUR 1143

FH Blocking Peptide
DF7460-BP	Affbiotech	1mg	EUR 195

Anti-FH Antibody
A02097	BosterBio	100ug/vial	EUR 334

Strain FH Protein
abx069951-1mg	Abbexa	1 mg	EUR 2555
Shipped within 5-10 working days.

FH Conjugated Antibody
C32975	SAB	100ul	EUR 397

FH cloning plasmid
CSB-CL008659HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1533 Sequence: atgtaccgagcacttcggctcctcgcgcgctcgcgtcccctcgtgcgggctccagccgcagccttagcttcggctcccggcttgggtggcgcggccgtgccctcgttttggcctccgaacgcggctcgaatggcaagccaaaattccttccggatagaatatgatacctttggtg Show more
Description: A cloning plasmid for the FH gene.

FH Monoclonal Antibody
ABM40073-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody
ABM40073-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Monoclonal Antibody
ABM40073-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic Peptide Applications tips:
Description: A monoclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB, IHC-P, IF. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen synthetic peptide

FH Polyclonal Antibody
ABP50158-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody
ABP50158-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody
ABP50158-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein Applications tips:
Description: A polyclonal antibody for detection of FH from Human, Mouse, Rat. This FH antibody is for WB. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FH Polyclonal Antibody
A62594	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

FH Rabbit pAb
A5688-100ul	Abclonal	100 ul	EUR 308

FH Rabbit pAb
A5688-200ul	Abclonal	200 ul	EUR 459

FH Rabbit pAb
A5688-20ul	Abclonal	20 ul	EUR 183

FH Rabbit pAb
A5688-50ul	Abclonal	50 ul	EUR 223

FH Polyclonal Antibody
ES1157-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

FH Polyclonal Antibody
ES1157-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FH from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA

anti- FH antibody
FNab03106	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: fumarate hydratase Uniprot ID: P07954 Gene ID: 2271 Research Area: Metabolism
Description: Antibody raised against FH

anti- FH antibody
FNab03107	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IF: 1:10-1:100 Immunogen: fumarate hydratase Uniprot ID: P07954 Gene ID: 2271 Research Area: Metabolism
Description: Antibody raised against FH

Anti-FH antibody
PAab03106	Lifescience Market	100 ug	EUR 355

Anti-FH antibody
PAab03107	Lifescience Market	100 ug	EUR 386

Anti-FH antibody
STJ27655	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy.

Anti-FH antibody
STJ96975	St John's Laboratory	200 µl	EUR 197
Description: FH is a protein encoded by the FH gene which is approximately 54,6 kDa. FH is localised to the cytoplasm and mitochondrion. It is involved in pyruvate metabolism, citric acid cycle and carbon metabolism. It is an enzymatic component of the tricarboxylic acid cycle and catalyses the formation of L-malate from fumarate. It can exist in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. FH is expressed in the cells of the nervous system, liver, skin, kidney and muscle. Mutations in the FH gene may result in fumarase deficiency. STJ96975 was developed from clone 7F1 and was affinity-purified from mouse ascites by affinity-chromatography using specific immunogen. This antibody detects endogenous FH proteins.

Anti-FH antibody
STJ97097	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to FH.

Anti-FH (3E7)
YF-MA10331	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (2E10)
YF-MA13012	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D8)
YF-MA13013	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (2C5)
YF-MA13014	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5D4)
YF-MA13015	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Anti-FH (5C12)
YF-MA13016	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FH

Human Tenascin M (TNM)ELISA Kit
201-12-2600	SunredBio	96 tests	EUR 440
This Tenascin M ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Tenascin M(TNM)ELISA Kit
QY-E03061	Qayee Biotechnology	96T	EUR 361

Polyclonal TNM / Teneurin-1 Antibody (N-Terminus)
APR13770G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNM / Teneurin-1 (N-Terminus). This antibody is tested and proven to work in the following applications:

FH (Phospho-Thr236) Antibody
11595-100ul	SAB	100ul	EUR 252

FH (Phospho-Thr236) Antibody
11595-50ul	SAB	50ul	EUR 187

Mycoplasma pneumoniae Ag (FH)
DAGA-503	Creative Diagnostics	1ml	EUR 897

Fumarate Hydratase (FH) Antibody
20-abx004350	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx112606	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx145820-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx159501	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx159502	Abbexa	EUR 272.00 EUR 230.00	100 ug 50 ug
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx141783	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx030263-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
abx030263-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx242106	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Fumarate Hydratase (FH) Antibody
20-abx242107	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human FH ELISA Kit
ELA-E1931h	Lifescience Market	96 Tests	EUR 824

FH/Fumarase Polyclonal Antibody
EA022-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FH/Fumarase from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IF

Supplemented Grace’s / TNM-FH