TRIM72 Elisa Kit Human

TRIM72 Elisa Kit Human 

To Order Contact us:

TRIM72 ELISA Kit (Mouse) (OKEH01716)

OKEH01716 96 Wells
EUR 740
Description: Description of target: Muscle-specific protein that plays a central role in cell membrane repair by nucleating the assembly of the repair machinery at injury sites. Specifically binds phosphatidylserine. Acts as a sensor of oxidation: upon membrane damage, entry of extracellular oxidative environment results in disulfide bond formation and homooligomerization at the injury site. This oligomerization acts as a nucleation site for recruitment of TRIM72-containing vesicles to the injury site, leading to membrane patch formation. Probably acts upstream of the Ca2+-dependent membrane resealing process. Required for transport of DYSF to sites of cell injury during repair patch formation. Regulates membrane budding and exocytosis. May be involved in the regulation of the mobility of KCNB1-containing endocytic vesicles.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

TRIM72 ELISA Kit (Rat) (OKEH03515)

OKEH03515 96 Wells
EUR 662
Description: Description of target: Muscle-specific protein that plays a central role in cell membrane repair by nucleating the assembly of the repair machinery at injury sites. Specifically binds phosphatidylserine. Acts as a sensor of oxidation: upon membrane damage, entry of extracellular oxidative environment results in disulfide bond formation and homooligomerization at the injury site. This oligomerization acts as a nucleation site for recruitment of TRIM72-containing vesicles to the injury site, leading to membrane patch formation. Probably acts upstream of the Ca2+-dependent membrane resealing process. Required for transport of DYSF to sites of cell injury during repair patch formation. Regulates membrane budding and exocytosis. May be involved in the regulation of the mobility of KCNB1-containing endocytic vesicles.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

TRIM72 ELISA Kit (Rat) (OKCA01009)

OKCA01009 96 Wells
EUR 833
Description: Description of target: Muscle-specific protein that plays a central role in cell membrane repair by nucleating the assembly of the repair machinery at injury sites. Specifically binds phosphatidylserine. Acts as a sensor of oxidation: upon membrane damage, entry of extracellular oxidative environment results in disulfide bond formation and homooligomerization at the injury site. This oligomerization acts as a nucleation site for recruitment of TRIM72-containing vesicles to the injury site, leading to membrane patch formation. Probably acts upstream of the Ca2+-dependent membrane resealing process. Required for transport of DYSF to sites of cell injury during repair patch formation. Regulates membrane budding and exocytosis. May be involved in the regulation of the mobility of KCNB1-containing endocytic vesicles.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.7 pg/mL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIM72 antibody

70R-2773 50 ug
EUR 467
Description: Rabbit polyclonal TRIM72 antibody raised against the N terminal of TRIM72

TRIM72 antibody

70R-2774 50 ug
EUR 467
Description: Rabbit polyclonal TRIM72 antibody raised against the middle region of TRIM72

TRIM72 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against TRIM72. Recognizes TRIM72 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000.IHC:1:200-500


YF-PA23131 50 ug
EUR 363
Description: Mouse polyclonal to TRIM72


YF-PA23132 100 ul
EUR 403
Description: Rabbit polyclonal to TRIM72


YF-PA23133 100 ug
EUR 403
Description: Rabbit polyclonal to TRIM72

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human TRIM72 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRIM72 Recombinant Protein (Human)

RP032974 100 ug Ask for price

TRIM72 Polyclonal Antibody

ES8180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRIM72 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

TRIM72 Polyclonal Antibody

ES8180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIM72 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

TRIM72 Polyclonal Antibody

ABP57181-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TRIM72 Polyclonal Antibody

ABP57181-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TRIM72 Polyclonal Antibody

ABP57181-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRIM72 from Human, Mouse, Rat. This TRIM72 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

TRIM72 Blocking Peptide

33R-4890 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIM72 antibody, catalog no. 70R-2774

TRIM72 Blocking Peptide

33R-1646 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIM72 antibody, catalog no. 70R-2773

TRIM72 cloning plasmid

CSB-CL744394HU-10ug 10ug
EUR 336
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 810
  • Sequence: atgtcggctgcgcccggcctcctgcaccaggagctgtcctgcccgctgtgcctgcagctgttcgacgcgcccgtgacagccgagtgcggccacagtttctgccgcgcctgcctaggccgcgtggccggggagccggcggcggatggcaccgttctctgcccctgctgccaggcccc
  • Show more
Description: A cloning plasmid for the TRIM72 gene.

Anti-TRIM72 antibody

STJ72398 100 µg
EUR 359

Anti-TRIM72 antibody

STJ97369 200 µl
EUR 197
Description: Rabbit polyclonal to TRIM72.

Anti-TRIM72 (2G1)

YF-MA20166 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72

Anti-TRIM72 (2B8)

YF-MA20167 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72

Anti-TRIM72 (3B5)

YF-MA20168 100 ug
EUR 363
Description: Mouse monoclonal to TRIM72

Human Tripartite motif-containing protein 72 (TRIM72) ELISA Kit

abx520312-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TRIM72/ Tripartite motif-containing protein 72 ELISA Kit

E2593Hu 1 Kit
EUR 571

Human Tripartite motif- containing protein 72, TRIM72 ELISA KIT

ELI-16595h 96 Tests
EUR 824

Human Tripartite motif-containing protein 72(TRIM72) ELISA kit

CSB-EL024511HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripartite motif-containing protein 72 (TRIM72) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tripartite motif-containing protein 72(TRIM72) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tripartite motif-containing protein 72(TRIM72) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

TRIM72 ORF Vector (Human) (pORF)

ORF010992 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse TRIM72 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRIM72/MG53 Polyclonal Antibody

EA151-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRIM72/MG53 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

TRIM72/MG53 Polyclonal Antibody

EA151-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIM72/MG53 from Human/ Rat/ Mouse. This antibody is tested and validated for WB, ELISA, IHC

Rat TRIM72 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRIM72 Recombinant Protein (Rat)

RP234770 100 ug Ask for price

TRIM72 Recombinant Protein (Mouse)

RP181271 100 ug Ask for price

pmCherry-C1-Trim72 Plasmid

PVTB50063-2a 2 ug
EUR 356

Anti-TRIM72, Biotinylated antibody

STJ73502 100 µg
EUR 359

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

TRIM72 sgRNA CRISPR Lentivector set (Human)

K2469301 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat Tripartite motif-containing protein 72 (TRIM72) ELISA Kit

abx520314-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Trim72/ Tripartite motif-containing protein 72 ELISA Kit

E1009Ra 1 Kit
EUR 571

Mouse Trim72/ Tripartite motif-containing protein 72 ELISA Kit

E1531Mo 1 Kit
EUR 571

Rabbit Tripartite motif- containing protein 72, TRIM72 ELISA KIT

ELI-51151Ra 96 Tests
EUR 928

Mouse Tripartite motif- containing protein 72, Trim72 ELISA KIT

ELI-51774m 96 Tests
EUR 865

Mouse Trim72(Tripartite motif-containing protein 72) ELISA Kit

EM0770 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q1XH17
  • Alias: Trim72/Tripartite motif-containing protein 72/Mitsugumin-53/Mg53
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Mouse Tripartite motif-containing protein 72 (TRIM72) ELISA Kit

abx255118-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tripartite motif-containing protein 72(TRIM72) ELISA kit

CSB-EL024511RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Tripartite motif-containing protein 72 (TRIM72) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Tripartite motif-containing protein 72(TRIM72) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Tripartite motif-containing protein 72(TRIM72) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Polyclonal TRIM72 Antibody (internal region)

APG00713G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRIM72 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal TRIM72 Antibody (C-term)

APR03643G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIM72 (C-term). This antibody is tested and proven to work in the following applications:

Trim72 ORF Vector (Rat) (pORF)

ORF078258 1.0 ug DNA
EUR 506

Trim72 ORF Vector (Mouse) (pORF)

ORF060425 1.0 ug DNA
EUR 506

pECMV-Trim72-m-FLAG Plasmid

PVT15022 2 ug
EUR 325

TRIM72 sgRNA CRISPR Lentivector (Human) (Target 1)

K2469302 1.0 ug DNA
EUR 154

TRIM72 sgRNA CRISPR Lentivector (Human) (Target 2)

K2469303 1.0 ug DNA
EUR 154

TRIM72 sgRNA CRISPR Lentivector (Human) (Target 3)

K2469304 1.0 ug DNA
EUR 154

Human Tripartite motif-containing protein 72 (TRIM72)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 32.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tripartite motif-containing protein 72(TRIM72),partial expressed in Mammalian cell

TRIM72 Protein Vector (Human) (pPB-C-His)

PV043965 500 ng
EUR 329

TRIM72 Protein Vector (Human) (pPB-N-His)

PV043966 500 ng
EUR 329

TRIM72 Protein Vector (Human) (pPM-C-HA)

PV043967 500 ng
EUR 329

TRIM72 Protein Vector (Human) (pPM-C-His)

PV043968 500 ng
EUR 329

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Trim72 ELISA Kit| Mouse Tripartite motif-containing protein 72 E

EF013380 96 Tests
EUR 689

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Trim72 sgRNA CRISPR Lentivector set (Mouse)

K4513401 3 x 1.0 ug
EUR 339

Trim72 sgRNA CRISPR Lentivector set (Rat)

K7197801 3 x 1.0 ug
EUR 339

pLVX-mCherry-c1-Trim72-Flag Plasmid

PVTB50063-4a 2 ug
EUR 356

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Tripartite Motif-Containing Protein 72 (TRIM72) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tripartite Motif-Containing Protein 72 (TRIM72) Antibody

abx026543-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tripartite Motif-Containing Protein 72 (TRIM72) Antibody

abx026543-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tripartite motif-containing protein 72 (TRIM72) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tripartite Motif-Containing Protein 72 (TRIM72) Antibody

abx431946-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Trim72 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4513402 1.0 ug DNA
EUR 154

Trim72 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4513403 1.0 ug DNA
EUR 154

Trim72 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4513404 1.0 ug DNA
EUR 154

Trim72 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7197802 1.0 ug DNA
EUR 154

Trim72 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7197803 1.0 ug DNA
EUR 154

Trim72 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7197804 1.0 ug DNA
EUR 154

pPLK/GFP+Puro-Trim72 shRNA-1 Plasmid

PVTB50063-3a 2 ug
EUR 356

pPLK/GFP+Puro-Trim72 shRNA-2 Plasmid

PVTB50063-3b 2 ug
EUR 356

pPLK/GFP+Puro-Trim72 shRNA-3 Plasmid

PVTB50063-3c 2 ug
EUR 356

TRIM72 Protein Vector (Rat) (pPB-C-His)

PV313030 500 ng
EUR 603

TRIM72 Protein Vector (Rat) (pPB-N-His)

PV313031 500 ng
EUR 603

TRIM72 Protein Vector (Rat) (pPM-C-HA)

PV313032 500 ng
EUR 603

TRIM72 Protein Vector (Rat) (pPM-C-His)

PV313033 500 ng
EUR 603

TRIM72 Protein Vector (Mouse) (pPB-C-His)

PV241698 500 ng
EUR 603

TRIM72 Protein Vector (Mouse) (pPB-N-His)

PV241699 500 ng
EUR 603

TRIM72 Protein Vector (Mouse) (pPM-C-HA)

PV241700 500 ng
EUR 603

TRIM72 Protein Vector (Mouse) (pPM-C-His)

PV241701 500 ng
EUR 603

Trim72 3'UTR GFP Stable Cell Line

TU171135 1.0 ml Ask for price

TRIM72 3'UTR GFP Stable Cell Line

TU076601 1.0 ml
EUR 1394

Trim72 3'UTR Luciferase Stable Cell Line

TU121135 1.0 ml Ask for price

TRIM72 3'UTR Luciferase Stable Cell Line

TU026601 1.0 ml
EUR 1394

Trim72 3'UTR Luciferase Stable Cell Line

TU222469 1.0 ml Ask for price

Trim72 3'UTR GFP Stable Cell Line

TU272469 1.0 ml Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

TRIM72 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2469305 3 x 1.0 ug
EUR 376

Tripartite Motif-Containing Protein 72 (TRIM72) Antibody (Biotin)

abx433476-100ug 100 ug
EUR 453
  • Shipped within 1-3 working days.

TRIM72 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV660661 1.0 ug DNA
EUR 682

TRIM72 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV660665 1.0 ug DNA
EUR 682

TRIM72 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV660666 1.0 ug DNA
EUR 682

TRIM72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2469306 1.0 ug DNA
EUR 167

TRIM72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2469307 1.0 ug DNA
EUR 167

TRIM72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2469308 1.0 ug DNA
EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4513405 3 x 1.0 ug
EUR 376

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7197805 3 x 1.0 ug
EUR 376

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4513406 1.0 ug DNA
EUR 167

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4513407 1.0 ug DNA
EUR 167

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4513408 1.0 ug DNA
EUR 167

TRIM72 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV660662 1.0 ug DNA
EUR 682

TRIM72 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV660663 1.0 ug DNA
EUR 740

TRIM72 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV660664 1.0 ug DNA
EUR 740

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7197806 1.0 ug DNA
EUR 167

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7197807 1.0 ug DNA
EUR 167

Trim72 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7197808 1.0 ug DNA
EUR 167


EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

TRIM72 Elisa Kit Human